ID: 1189352972

View in Genome Browser
Species Human (GRCh38)
Location X:40290884-40290906
Sequence TGTTTTGTCTACATGTTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189352972_1189352984 19 Left 1189352972 X:40290884-40290906 CCAGGAAACATGTAGACAAAACA No data
Right 1189352984 X:40290926-40290948 AGGGGGCATCTGAGGGCACGAGG No data
1189352972_1189352976 -5 Left 1189352972 X:40290884-40290906 CCAGGAAACATGTAGACAAAACA No data
Right 1189352976 X:40290902-40290924 AAACAGAGAAGGGGAAGAGCAGG No data
1189352972_1189352982 11 Left 1189352972 X:40290884-40290906 CCAGGAAACATGTAGACAAAACA No data
Right 1189352982 X:40290918-40290940 GAGCAGGGAGGGGGCATCTGAGG No data
1189352972_1189352986 30 Left 1189352972 X:40290884-40290906 CCAGGAAACATGTAGACAAAACA No data
Right 1189352986 X:40290937-40290959 GAGGGCACGAGGCCCAGGACTGG No data
1189352972_1189352978 -1 Left 1189352972 X:40290884-40290906 CCAGGAAACATGTAGACAAAACA No data
Right 1189352978 X:40290906-40290928 AGAGAAGGGGAAGAGCAGGGAGG No data
1189352972_1189352979 0 Left 1189352972 X:40290884-40290906 CCAGGAAACATGTAGACAAAACA No data
Right 1189352979 X:40290907-40290929 GAGAAGGGGAAGAGCAGGGAGGG No data
1189352972_1189352980 1 Left 1189352972 X:40290884-40290906 CCAGGAAACATGTAGACAAAACA No data
Right 1189352980 X:40290908-40290930 AGAAGGGGAAGAGCAGGGAGGGG No data
1189352972_1189352985 25 Left 1189352972 X:40290884-40290906 CCAGGAAACATGTAGACAAAACA No data
Right 1189352985 X:40290932-40290954 CATCTGAGGGCACGAGGCCCAGG No data
1189352972_1189352981 2 Left 1189352972 X:40290884-40290906 CCAGGAAACATGTAGACAAAACA No data
Right 1189352981 X:40290909-40290931 GAAGGGGAAGAGCAGGGAGGGGG No data
1189352972_1189352977 -4 Left 1189352972 X:40290884-40290906 CCAGGAAACATGTAGACAAAACA No data
Right 1189352977 X:40290903-40290925 AACAGAGAAGGGGAAGAGCAGGG No data
1189352972_1189352983 12 Left 1189352972 X:40290884-40290906 CCAGGAAACATGTAGACAAAACA No data
Right 1189352983 X:40290919-40290941 AGCAGGGAGGGGGCATCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189352972 Original CRISPR TGTTTTGTCTACATGTTTCC TGG (reversed) Intergenic
No off target data available for this crispr