ID: 1189352984

View in Genome Browser
Species Human (GRCh38)
Location X:40290926-40290948
Sequence AGGGGGCATCTGAGGGCACG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189352972_1189352984 19 Left 1189352972 X:40290884-40290906 CCAGGAAACATGTAGACAAAACA No data
Right 1189352984 X:40290926-40290948 AGGGGGCATCTGAGGGCACGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189352984 Original CRISPR AGGGGGCATCTGAGGGCACG AGG Intergenic
No off target data available for this crispr