ID: 1189353866

View in Genome Browser
Species Human (GRCh38)
Location X:40297064-40297086
Sequence CTGTCTGCCTGGAATGATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189353861_1189353866 2 Left 1189353861 X:40297039-40297061 CCCTTTGCGGTTCTTCTTCCTAA No data
Right 1189353866 X:40297064-40297086 CTGTCTGCCTGGAATGATGATGG No data
1189353862_1189353866 1 Left 1189353862 X:40297040-40297062 CCTTTGCGGTTCTTCTTCCTAAA No data
Right 1189353866 X:40297064-40297086 CTGTCTGCCTGGAATGATGATGG No data
1189353859_1189353866 10 Left 1189353859 X:40297031-40297053 CCCTTTTGCCCTTTGCGGTTCTT No data
Right 1189353866 X:40297064-40297086 CTGTCTGCCTGGAATGATGATGG No data
1189353860_1189353866 9 Left 1189353860 X:40297032-40297054 CCTTTTGCCCTTTGCGGTTCTTC No data
Right 1189353866 X:40297064-40297086 CTGTCTGCCTGGAATGATGATGG No data
1189353857_1189353866 27 Left 1189353857 X:40297014-40297036 CCTTGAGCTGGGAGGATCCCTTT No data
Right 1189353866 X:40297064-40297086 CTGTCTGCCTGGAATGATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189353866 Original CRISPR CTGTCTGCCTGGAATGATGA TGG Intergenic
No off target data available for this crispr