ID: 1189354440

View in Genome Browser
Species Human (GRCh38)
Location X:40300278-40300300
Sequence CCTGAGGCCCAGGCGGACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189354440_1189354447 -1 Left 1189354440 X:40300278-40300300 CCAGGGTCCGCCTGGGCCTCAGG No data
Right 1189354447 X:40300300-40300322 GGGTCCCAGATTTGCCTTCTTGG No data
1189354440_1189354450 9 Left 1189354440 X:40300278-40300300 CCAGGGTCCGCCTGGGCCTCAGG No data
Right 1189354450 X:40300310-40300332 TTTGCCTTCTTGGTTGCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189354440 Original CRISPR CCTGAGGCCCAGGCGGACCC TGG (reversed) Intergenic
No off target data available for this crispr