ID: 1189354911

View in Genome Browser
Species Human (GRCh38)
Location X:40303279-40303301
Sequence TCACTGTGTTGTTTGTGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189354905_1189354911 17 Left 1189354905 X:40303239-40303261 CCAGATGCTAGAAATATAGCAGG No data
Right 1189354911 X:40303279-40303301 TCACTGTGTTGTTTGTGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189354911 Original CRISPR TCACTGTGTTGTTTGTGGGG AGG Intergenic
No off target data available for this crispr