ID: 1189355076

View in Genome Browser
Species Human (GRCh38)
Location X:40304421-40304443
Sequence TAACTCATGAGTGATGGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189355076_1189355082 -7 Left 1189355076 X:40304421-40304443 CCTGTCCCATCACTCATGAGTTA No data
Right 1189355082 X:40304437-40304459 TGAGTTAAGGGCTGTTGCCTGGG No data
1189355076_1189355081 -8 Left 1189355076 X:40304421-40304443 CCTGTCCCATCACTCATGAGTTA No data
Right 1189355081 X:40304436-40304458 ATGAGTTAAGGGCTGTTGCCTGG No data
1189355076_1189355084 9 Left 1189355076 X:40304421-40304443 CCTGTCCCATCACTCATGAGTTA No data
Right 1189355084 X:40304453-40304475 GCCTGGGGTTGATGATTCCTTGG No data
1189355076_1189355083 -6 Left 1189355076 X:40304421-40304443 CCTGTCCCATCACTCATGAGTTA No data
Right 1189355083 X:40304438-40304460 GAGTTAAGGGCTGTTGCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189355076 Original CRISPR TAACTCATGAGTGATGGGAC AGG (reversed) Intergenic
No off target data available for this crispr