ID: 1189355082

View in Genome Browser
Species Human (GRCh38)
Location X:40304437-40304459
Sequence TGAGTTAAGGGCTGTTGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189355076_1189355082 -7 Left 1189355076 X:40304421-40304443 CCTGTCCCATCACTCATGAGTTA No data
Right 1189355082 X:40304437-40304459 TGAGTTAAGGGCTGTTGCCTGGG No data
1189355075_1189355082 -4 Left 1189355075 X:40304418-40304440 CCTCCTGTCCCATCACTCATGAG No data
Right 1189355082 X:40304437-40304459 TGAGTTAAGGGCTGTTGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189355082 Original CRISPR TGAGTTAAGGGCTGTTGCCT GGG Intergenic
No off target data available for this crispr