ID: 1189355084

View in Genome Browser
Species Human (GRCh38)
Location X:40304453-40304475
Sequence GCCTGGGGTTGATGATTCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189355076_1189355084 9 Left 1189355076 X:40304421-40304443 CCTGTCCCATCACTCATGAGTTA No data
Right 1189355084 X:40304453-40304475 GCCTGGGGTTGATGATTCCTTGG No data
1189355080_1189355084 3 Left 1189355080 X:40304427-40304449 CCATCACTCATGAGTTAAGGGCT No data
Right 1189355084 X:40304453-40304475 GCCTGGGGTTGATGATTCCTTGG No data
1189355079_1189355084 4 Left 1189355079 X:40304426-40304448 CCCATCACTCATGAGTTAAGGGC No data
Right 1189355084 X:40304453-40304475 GCCTGGGGTTGATGATTCCTTGG No data
1189355075_1189355084 12 Left 1189355075 X:40304418-40304440 CCTCCTGTCCCATCACTCATGAG No data
Right 1189355084 X:40304453-40304475 GCCTGGGGTTGATGATTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189355084 Original CRISPR GCCTGGGGTTGATGATTCCT TGG Intergenic
No off target data available for this crispr