ID: 1189355965

View in Genome Browser
Species Human (GRCh38)
Location X:40310141-40310163
Sequence CAGCCCCTGAACGTGGGCTT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189355955_1189355965 6 Left 1189355955 X:40310112-40310134 CCCTCCAGCCCCAGCCGGAGAGA No data
Right 1189355965 X:40310141-40310163 CAGCCCCTGAACGTGGGCTTCGG No data
1189355961_1189355965 -4 Left 1189355961 X:40310122-40310144 CCAGCCGGAGAGAGGCTCGCAGC No data
Right 1189355965 X:40310141-40310163 CAGCCCCTGAACGTGGGCTTCGG No data
1189355951_1189355965 30 Left 1189355951 X:40310088-40310110 CCTCAGGCCTTCCACAGCTGTCT No data
Right 1189355965 X:40310141-40310163 CAGCCCCTGAACGTGGGCTTCGG No data
1189355952_1189355965 23 Left 1189355952 X:40310095-40310117 CCTTCCACAGCTGTCTTCCCTCC No data
Right 1189355965 X:40310141-40310163 CAGCCCCTGAACGTGGGCTTCGG No data
1189355962_1189355965 -8 Left 1189355962 X:40310126-40310148 CCGGAGAGAGGCTCGCAGCCCCT No data
Right 1189355965 X:40310141-40310163 CAGCCCCTGAACGTGGGCTTCGG No data
1189355956_1189355965 5 Left 1189355956 X:40310113-40310135 CCTCCAGCCCCAGCCGGAGAGAG No data
Right 1189355965 X:40310141-40310163 CAGCCCCTGAACGTGGGCTTCGG No data
1189355959_1189355965 -2 Left 1189355959 X:40310120-40310142 CCCCAGCCGGAGAGAGGCTCGCA No data
Right 1189355965 X:40310141-40310163 CAGCCCCTGAACGTGGGCTTCGG No data
1189355958_1189355965 2 Left 1189355958 X:40310116-40310138 CCAGCCCCAGCCGGAGAGAGGCT No data
Right 1189355965 X:40310141-40310163 CAGCCCCTGAACGTGGGCTTCGG No data
1189355953_1189355965 19 Left 1189355953 X:40310099-40310121 CCACAGCTGTCTTCCCTCCAGCC No data
Right 1189355965 X:40310141-40310163 CAGCCCCTGAACGTGGGCTTCGG No data
1189355960_1189355965 -3 Left 1189355960 X:40310121-40310143 CCCAGCCGGAGAGAGGCTCGCAG No data
Right 1189355965 X:40310141-40310163 CAGCCCCTGAACGTGGGCTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189355965 Original CRISPR CAGCCCCTGAACGTGGGCTT CGG Intergenic
No off target data available for this crispr