ID: 1189357539

View in Genome Browser
Species Human (GRCh38)
Location X:40322645-40322667
Sequence GGGTTGCTTTGGAGTCTGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189357528_1189357539 18 Left 1189357528 X:40322604-40322626 CCATGACCATCTTTCCTTCCTAC No data
Right 1189357539 X:40322645-40322667 GGGTTGCTTTGGAGTCTGTTAGG No data
1189357537_1189357539 -10 Left 1189357537 X:40322632-40322654 CCAAATGAGATATGGGTTGCTTT No data
Right 1189357539 X:40322645-40322667 GGGTTGCTTTGGAGTCTGTTAGG No data
1189357535_1189357539 -5 Left 1189357535 X:40322627-40322649 CCTACCCAAATGAGATATGGGTT No data
Right 1189357539 X:40322645-40322667 GGGTTGCTTTGGAGTCTGTTAGG No data
1189357534_1189357539 -4 Left 1189357534 X:40322626-40322648 CCCTACCCAAATGAGATATGGGT No data
Right 1189357539 X:40322645-40322667 GGGTTGCTTTGGAGTCTGTTAGG No data
1189357529_1189357539 12 Left 1189357529 X:40322610-40322632 CCATCTTTCCTTCCTACCCTACC No data
Right 1189357539 X:40322645-40322667 GGGTTGCTTTGGAGTCTGTTAGG No data
1189357530_1189357539 4 Left 1189357530 X:40322618-40322640 CCTTCCTACCCTACCCAAATGAG No data
Right 1189357539 X:40322645-40322667 GGGTTGCTTTGGAGTCTGTTAGG No data
1189357536_1189357539 -9 Left 1189357536 X:40322631-40322653 CCCAAATGAGATATGGGTTGCTT No data
Right 1189357539 X:40322645-40322667 GGGTTGCTTTGGAGTCTGTTAGG No data
1189357531_1189357539 0 Left 1189357531 X:40322622-40322644 CCTACCCTACCCAAATGAGATAT No data
Right 1189357539 X:40322645-40322667 GGGTTGCTTTGGAGTCTGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189357539 Original CRISPR GGGTTGCTTTGGAGTCTGTT AGG Intergenic
No off target data available for this crispr