ID: 1189360602

View in Genome Browser
Species Human (GRCh38)
Location X:40347866-40347888
Sequence GACCAGCTAATTAATGGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189360602_1189360612 22 Left 1189360602 X:40347866-40347888 CCTCTTCCATTAATTAGCTGGTC No data
Right 1189360612 X:40347911-40347933 CTAAGTGTGAGCTGGGGCAGAGG No data
1189360602_1189360609 16 Left 1189360602 X:40347866-40347888 CCTCTTCCATTAATTAGCTGGTC No data
Right 1189360609 X:40347905-40347927 GAAGCCCTAAGTGTGAGCTGGGG No data
1189360602_1189360608 15 Left 1189360602 X:40347866-40347888 CCTCTTCCATTAATTAGCTGGTC No data
Right 1189360608 X:40347904-40347926 TGAAGCCCTAAGTGTGAGCTGGG No data
1189360602_1189360607 14 Left 1189360602 X:40347866-40347888 CCTCTTCCATTAATTAGCTGGTC No data
Right 1189360607 X:40347903-40347925 ATGAAGCCCTAAGTGTGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189360602 Original CRISPR GACCAGCTAATTAATGGAAG AGG (reversed) Intergenic
No off target data available for this crispr