ID: 1189360603

View in Genome Browser
Species Human (GRCh38)
Location X:40347872-40347894
Sequence CTTTGTGACCAGCTAATTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189360603_1189360607 8 Left 1189360603 X:40347872-40347894 CCATTAATTAGCTGGTCACAAAG No data
Right 1189360607 X:40347903-40347925 ATGAAGCCCTAAGTGTGAGCTGG No data
1189360603_1189360612 16 Left 1189360603 X:40347872-40347894 CCATTAATTAGCTGGTCACAAAG No data
Right 1189360612 X:40347911-40347933 CTAAGTGTGAGCTGGGGCAGAGG No data
1189360603_1189360613 25 Left 1189360603 X:40347872-40347894 CCATTAATTAGCTGGTCACAAAG No data
Right 1189360613 X:40347920-40347942 AGCTGGGGCAGAGGCACAGATGG No data
1189360603_1189360609 10 Left 1189360603 X:40347872-40347894 CCATTAATTAGCTGGTCACAAAG No data
Right 1189360609 X:40347905-40347927 GAAGCCCTAAGTGTGAGCTGGGG No data
1189360603_1189360608 9 Left 1189360603 X:40347872-40347894 CCATTAATTAGCTGGTCACAAAG No data
Right 1189360608 X:40347904-40347926 TGAAGCCCTAAGTGTGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189360603 Original CRISPR CTTTGTGACCAGCTAATTAA TGG (reversed) Intergenic
No off target data available for this crispr