ID: 1189360608

View in Genome Browser
Species Human (GRCh38)
Location X:40347904-40347926
Sequence TGAAGCCCTAAGTGTGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189360603_1189360608 9 Left 1189360603 X:40347872-40347894 CCATTAATTAGCTGGTCACAAAG No data
Right 1189360608 X:40347904-40347926 TGAAGCCCTAAGTGTGAGCTGGG No data
1189360601_1189360608 16 Left 1189360601 X:40347865-40347887 CCCTCTTCCATTAATTAGCTGGT No data
Right 1189360608 X:40347904-40347926 TGAAGCCCTAAGTGTGAGCTGGG No data
1189360602_1189360608 15 Left 1189360602 X:40347866-40347888 CCTCTTCCATTAATTAGCTGGTC No data
Right 1189360608 X:40347904-40347926 TGAAGCCCTAAGTGTGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189360608 Original CRISPR TGAAGCCCTAAGTGTGAGCT GGG Intergenic
No off target data available for this crispr