ID: 1189362082

View in Genome Browser
Species Human (GRCh38)
Location X:40360515-40360537
Sequence TCCGTGGGAAAGGAGATCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 171}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189362076_1189362082 12 Left 1189362076 X:40360480-40360502 CCATCGCGATGGCCATGTCGGCC No data
Right 1189362082 X:40360515-40360537 TCCGTGGGAAAGGAGATCAGTGG 0: 1
1: 0
2: 0
3: 15
4: 171
1189362071_1189362082 25 Left 1189362071 X:40360467-40360489 CCTCCCATCAGAGCCATCGCGAT No data
Right 1189362082 X:40360515-40360537 TCCGTGGGAAAGGAGATCAGTGG 0: 1
1: 0
2: 0
3: 15
4: 171
1189362073_1189362082 22 Left 1189362073 X:40360470-40360492 CCCATCAGAGCCATCGCGATGGC No data
Right 1189362082 X:40360515-40360537 TCCGTGGGAAAGGAGATCAGTGG 0: 1
1: 0
2: 0
3: 15
4: 171
1189362080_1189362082 -9 Left 1189362080 X:40360501-40360523 CCTCTATCACAGTGTCCGTGGGA 0: 1
1: 0
2: 0
3: 11
4: 103
Right 1189362082 X:40360515-40360537 TCCGTGGGAAAGGAGATCAGTGG 0: 1
1: 0
2: 0
3: 15
4: 171
1189362077_1189362082 0 Left 1189362077 X:40360492-40360514 CCATGTCGGCCTCTATCACAGTG 0: 1
1: 1
2: 5
3: 11
4: 90
Right 1189362082 X:40360515-40360537 TCCGTGGGAAAGGAGATCAGTGG 0: 1
1: 0
2: 0
3: 15
4: 171
1189362074_1189362082 21 Left 1189362074 X:40360471-40360493 CCATCAGAGCCATCGCGATGGCC No data
Right 1189362082 X:40360515-40360537 TCCGTGGGAAAGGAGATCAGTGG 0: 1
1: 0
2: 0
3: 15
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189362082 Original CRISPR TCCGTGGGAAAGGAGATCAG TGG Intergenic
903145348 1:21368573-21368595 ACCGTGGGAAAGGAGAGGGGAGG - Intergenic
904307598 1:29600143-29600165 TCTGTGGGAAAGGAGAAAATGGG + Intergenic
904595934 1:31645269-31645291 GCCGCGGGAAAGGAGACGAGGGG + Intergenic
905320587 1:37114097-37114119 TCCGTGGGAAAAGATAGCACTGG - Intergenic
907307823 1:53523336-53523358 TCAGTGGGAAAGAAGATGGGAGG - Intronic
909465318 1:75967296-75967318 TTCGTGGTAATGGAGAGCAGTGG - Intergenic
910800731 1:91142684-91142706 TAGGTGGGAAAAAAGATCAGTGG - Intergenic
910832940 1:91478649-91478671 TCCTTGAGAAAGGAGACCATAGG - Intergenic
911992298 1:104715412-104715434 CCTTTGGGAAAGGAGGTCAGAGG + Intergenic
913191736 1:116418723-116418745 TCCGTCTGCAAGGAGAGCAGAGG + Intergenic
917448009 1:175123242-175123264 TCCTTGGAAATGGAGACCAGGGG + Intronic
917488676 1:175478710-175478732 ACTGAGGAAAAGGAGATCAGGGG + Intronic
918326840 1:183418127-183418149 TGCCTGGGAAAGGAGAGGAGCGG + Intronic
920949603 1:210560074-210560096 TTCGTGGGAAAGGAGCACACAGG - Intronic
921181078 1:212631586-212631608 TCAGTGGGAAAAGAAAACAGGGG - Intergenic
923630891 1:235649260-235649282 CCCGTGGAAAAGGACCTCAGTGG - Intronic
923994051 1:239471633-239471655 TCAGTGGGAGAGGAGAGAAGGGG - Intronic
1063502935 10:6571054-6571076 GCCGTGGGAAGGAAGATCATTGG + Intronic
1064580402 10:16787484-16787506 TCAGTGGGACAGGAAAACAGAGG - Intronic
1067047533 10:42992921-42992943 TCTGTGGGAATGTAGCTCAGAGG - Intergenic
1068121192 10:52783571-52783593 TCCCTGGGAGAGGAGAACATTGG + Intergenic
1071992705 10:91115459-91115481 TGCTTGGGAAAGGAGCTCAGAGG + Intergenic
1073542977 10:104327600-104327622 TCCAAGGGATAGGAGAACAGGGG + Intronic
1073634863 10:105187397-105187419 TTAGTGGTAAAGGAGGTCAGTGG - Intronic
1076711703 10:132339241-132339263 TCCGTGGGACAGTAGAATAGAGG + Intronic
1078210565 11:9266144-9266166 TCTATGGGAAAGGAAATCGGAGG - Intergenic
1078864590 11:15285117-15285139 TCGGTAGCAAAGGAGCTCAGTGG + Intergenic
1079518521 11:21297106-21297128 TCTGTGGGAAAAGGGATCAAAGG + Intronic
1082255986 11:50033639-50033661 TCAGTGGGGAAGGAGGTTAGAGG - Intergenic
1083316909 11:61821004-61821026 TAGGTGGGTAAGGAGATGAGAGG - Intronic
1084890447 11:72234187-72234209 GCCCTGGGACAGGAAATCAGGGG - Intronic
1086434016 11:86763758-86763780 CCGCTGGGAAAGGAGATTAGGGG - Intergenic
1088355771 11:108942470-108942492 TAGGTGGGAAAGGAATTCAGTGG + Intergenic
1090642225 11:128739546-128739568 TCCTTGGGAATGGAGAGTAGTGG - Intronic
1091670244 12:2447373-2447395 GGCGTGGGAAAGGAGTGCAGGGG - Intronic
1096210690 12:49763335-49763357 TCCATTGGAAAGAAGTTCAGTGG + Exonic
1097168642 12:57099578-57099600 TCTGTGGGAACGGAGACTAGTGG - Intronic
1097190581 12:57217554-57217576 TCCGTGGGAAATGTGATGGGAGG - Intronic
1097619232 12:61920368-61920390 TCCCTGGGAGAGGAGATTTGTGG - Intronic
1098042603 12:66367514-66367536 TCCATGGAAAAGGTCATCAGGGG + Intronic
1102026669 12:109717672-109717694 TCCTTGTCAAAGGAGATCAATGG - Intronic
1104746662 12:131215156-131215178 CCCCTGGGAATGGGGATCAGTGG + Intergenic
1104785898 12:131447758-131447780 CCCCTGGGAATGGGGATCAGTGG - Intergenic
1105730543 13:23211240-23211262 TCCGTGGGTAAGTAGATCCCTGG + Intronic
1107415525 13:40196391-40196413 TCTGTGGGAAAGGAGAGCATGGG + Intergenic
1113205033 13:107907351-107907373 GCCGTGGGAAAGGATGTCTGTGG - Intergenic
1113911536 13:113843616-113843638 TCCGTGGGAAAGGAAAGAAATGG + Intronic
1115545663 14:34462766-34462788 TCCGTGTAAGAGGAGATAAGGGG + Intronic
1122059752 14:99129135-99129157 TGAGTGGGAAGGGAGATGAGCGG + Intergenic
1122311978 14:100803232-100803254 TCCGTGGGAAAGGGAAACTGGGG + Intergenic
1122703847 14:103608058-103608080 TCCAAGGGAAAGGCGATCTGGGG - Intronic
1122957313 14:105076726-105076748 TCCGTGGGAGAGGAGGACTGGGG + Intergenic
1124630142 15:31331526-31331548 TGCCTGGGAAAGCAGAGCAGAGG + Intronic
1124709746 15:31997970-31997992 TCAGAAGGAAAGAAGATCAGTGG + Intergenic
1125352307 15:38780844-38780866 TCAGTGGGAAAGGGGAGGAGGGG - Intergenic
1126985676 15:54304571-54304593 TCTAAGGGAAAGGAGGTCAGAGG - Intronic
1127279251 15:57475054-57475076 ACTGTGAGAAAGGAGGTCAGAGG - Intronic
1129612559 15:77072069-77072091 TGCCTGGGAAAGGTGATGAGTGG - Intronic
1130684668 15:86026202-86026224 GCCGTGGGAAAGGAGAAAAATGG + Intergenic
1131228206 15:90642508-90642530 TCGGTGCGGACGGAGATCAGTGG - Exonic
1131959178 15:97770369-97770391 TTAGTGGAAATGGAGATCAGTGG + Intergenic
1132497555 16:270983-271005 TTTCTGGGAAAGGAGTTCAGTGG - Exonic
1137402995 16:48168415-48168437 GCTGTGGGAAAAGAGCTCAGTGG - Intronic
1138383248 16:56618053-56618075 TAAGTGGGAAAGGAGCTCTGAGG + Intergenic
1138384406 16:56626342-56626364 TGAGTGGGAAAGGAGCTCTGAGG + Intronic
1138385505 16:56633216-56633238 TGAGTGGGAAAGGAGCTCTGAGG + Intronic
1138386063 16:56636315-56636337 TGAGTGGGAAAGGAGCTCTGAGG + Intergenic
1138389308 16:56658548-56658570 TGAGTGGGAAAGGAGCTCTGAGG + Intronic
1138390549 16:56667478-56667500 TGAGTGGGAAAGGAGCTCTGAGG - Intronic
1138392889 16:56683038-56683060 TGAGTGGGAAAGGAGCTCTGGGG + Intronic
1138440757 16:57033722-57033744 TCCGAGGCAAGGGAGAGCAGGGG + Intronic
1141601118 16:85126944-85126966 TCCGTGTGAAAGGGGAGCCGGGG - Intergenic
1142177616 16:88652182-88652204 TCTCTGAGAAAGGAGCTCAGTGG - Exonic
1143445310 17:7005838-7005860 TGCCTGGGACAGGAGATCACAGG - Exonic
1146988008 17:37240655-37240677 TCAGAGGGAAAGCAGTTCAGTGG - Intronic
1148856591 17:50582349-50582371 TCCCTGGAAATGGAGAGCAGAGG + Intronic
1151833114 17:76567365-76567387 TCCGAGGTAAGGGATATCAGGGG + Intronic
1153322458 18:3786501-3786523 TCCATGGAAAAGGCTATCAGTGG + Intronic
1153598504 18:6754809-6754831 TCCAAGGGTAAGGAGGTCAGGGG + Intronic
1154162849 18:11992771-11992793 GCCGTGGTAAAGGGGTTCAGCGG + Intronic
1154496974 18:14968815-14968837 CCCATAGGAAAGGAGGTCAGTGG + Intergenic
1156735296 18:40250347-40250369 TCCCTGGCAAAAGAGCTCAGGGG + Intergenic
1158478069 18:57798002-57798024 TTGGTGAGAAAGCAGATCAGAGG - Intronic
1162320467 19:9968427-9968449 CTGGTGAGAAAGGAGATCAGGGG - Exonic
1162338697 19:10078270-10078292 TCTGTGAGAAAGGAAATGAGAGG + Intergenic
1166391688 19:42412138-42412160 TGGCTGGGAAAGGATATCAGAGG - Intronic
1166719690 19:44989958-44989980 TCCCTGGGAAGGAAGATCTGTGG - Intronic
925042916 2:747651-747673 TCCTTAGGAAAAGAGATCATGGG + Intergenic
925971808 2:9111322-9111344 GCCGTGGGAAAGGAGGCTAGAGG + Intergenic
927338572 2:21953497-21953519 TCTGTGGGAAATTAGCTCAGTGG + Intergenic
927957425 2:27217534-27217556 GCCATGGGAAGGGAGCTCAGAGG - Exonic
928669670 2:33589053-33589075 ACCATGGGAAAGGAGCTCTGGGG - Intronic
933082329 2:78006399-78006421 TCCTTGGGAAAGGTGTTGAGTGG + Intergenic
933345675 2:81082452-81082474 ACCCTGGACAAGGAGATCAGAGG + Intergenic
939146110 2:138416818-138416840 TCCCTGGGAAAGGGGCTCATTGG - Intergenic
939817773 2:146917236-146917258 TCCCTGGCAAAGGGGATTAGAGG + Intergenic
940557711 2:155252475-155252497 TTCCTGTGAAAGGAGATAAGTGG + Intergenic
943369921 2:187003166-187003188 TCCGTGGGGGAGGAAATGAGCGG + Intergenic
944343204 2:198629104-198629126 TCCCTGGGAAAGTACATCAAGGG - Intergenic
944581917 2:201138846-201138868 TCCATGGGGGAGGAGATCAGCGG + Intronic
947154909 2:227152797-227152819 TTCGTGGGAAGGTAGATGAGTGG - Intronic
947186015 2:227456364-227456386 TTTGTGGGACAGGAGGTCAGGGG + Intergenic
1171388088 20:24783631-24783653 TCCTTGGGAAAGGAGGTGTGAGG - Intergenic
1178109300 21:29354502-29354524 TTCGTGGGAAATCAGAACAGTGG + Intronic
1181544183 22:23591823-23591845 TTCGTGGGAAAGGAGAAAATAGG - Intergenic
1181870266 22:25892617-25892639 TCCAGGGGAATGGAGATCAGGGG + Intronic
1185393533 22:50575492-50575514 ACCGTGGGAAAGGAGAGAAGAGG + Intronic
949748660 3:7325604-7325626 AGCCTGGGAAAGGAGACCAGCGG + Intronic
950534078 3:13569391-13569413 TCCCTGGGAAAGGGGAGGAGTGG + Intronic
950831240 3:15878236-15878258 TCCATAGGGGAGGAGATCAGCGG - Intergenic
952912862 3:38205317-38205339 TCTGTGGGGAAGATGATCAGTGG + Intronic
953282679 3:41574411-41574433 TAAGTGGGAATGGAGAGCAGAGG - Intronic
954201919 3:49028468-49028490 TCCATGGGAGAGGAAACCAGTGG + Exonic
966344520 3:178963804-178963826 TCTTTGGGAAAGAGGATCAGAGG - Intergenic
967954047 3:194863458-194863480 ACCGTGGGAAAGGAAATGGGAGG - Intergenic
967975930 3:195034835-195034857 TCCGTGGGAAAGGTGAACTGAGG + Intergenic
968699291 4:2047122-2047144 TCCGTGGGGAGGAAGAACAGGGG - Intergenic
969170480 4:5358608-5358630 TCCTTGTGGAAGGAGATCATTGG + Intronic
969689417 4:8696074-8696096 TCCCTGGGGAAGCAGATCTGGGG - Intergenic
969815758 4:9686211-9686233 TAGGTTGGAAAGGAGATCATGGG - Intergenic
975985550 4:80198429-80198451 TCCGTTGAAAAGGAGATAAGAGG + Intronic
977659256 4:99563792-99563814 TCCGGGGGAGAGGGGAGCAGTGG - Intronic
979700784 4:123665573-123665595 TCCATGGAAAAGAAGATCAGAGG + Intergenic
983541672 4:168917898-168917920 TCCGAGGAAAATGAAATCAGAGG + Intronic
984288767 4:177766530-177766552 TTCCTTGGAAAGGACATCAGGGG + Intronic
986550326 5:8946912-8946934 TCCATGGGAAAGAAGACCAAAGG - Intergenic
986778427 5:11041495-11041517 TCCCTGTGAAAAGAGCTCAGAGG - Intronic
990649649 5:57883689-57883711 TATTTGGGCAAGGAGATCAGTGG - Intergenic
993524508 5:88947763-88947785 ACAGTGAGAAAGGAGATCAGGGG + Intergenic
993778955 5:92041615-92041637 TCCTTGGGAAAGGAGAGTATGGG - Intergenic
999109499 5:149106057-149106079 TCATTGGGAAAGGACATAAGGGG + Intergenic
999260439 5:150235253-150235275 TCTGTGGGACAGAAGATCTGGGG + Intronic
999663339 5:153888466-153888488 TTTGTAGGAAATGAGATCAGAGG + Intergenic
999670322 5:153953938-153953960 TCAGTGGAAAAGCAGTTCAGTGG + Intergenic
1000071539 5:157744468-157744490 GCCGTGGGAAAGGTCTTCAGCGG + Intronic
1001502133 5:172245296-172245318 TCCTTGGTAATGGAGATCATGGG + Intronic
1003240974 6:4345592-4345614 TCTGTGGGTCAGGAGTTCAGGGG + Intergenic
1007066608 6:38997087-38997109 TGCTGGGGAAAGGGGATCAGGGG - Intronic
1007693736 6:43718778-43718800 TCCCTGAGACAGGAGATCGGAGG + Intergenic
1007837641 6:44686511-44686533 TCAGTGGGAAAGGAGGGAAGGGG - Intergenic
1008539985 6:52538118-52538140 TCCCTGTGAAGGAAGATCAGAGG + Intronic
1009991807 6:70852378-70852400 TCTTTGGGAAAGGGGATCGGGGG + Intronic
1010567628 6:77435936-77435958 GCTGTGAGAAAGGAGAGCAGAGG - Intergenic
1012475795 6:99613803-99613825 TCCGGGGGGACGGAGAGCAGAGG - Exonic
1014728138 6:124998229-124998251 TCCATGGGATAGGAGAATAGAGG - Intronic
1021401929 7:20219472-20219494 TCCCTGAGGGAGGAGATCAGTGG - Intergenic
1022485291 7:30773013-30773035 TGCGAGGGAGAGGAGACCAGGGG - Intronic
1026607257 7:71826704-71826726 CCTGTAGGAAATGAGATCAGAGG - Intronic
1026978758 7:74514554-74514576 TGCATTGGAAAGGAGATGAGAGG - Intronic
1027602213 7:80253397-80253419 GCAGTAGGAGAGGAGATCAGAGG + Intergenic
1028529718 7:91825090-91825112 TCCTTGGGAAGGGATACCAGTGG - Intronic
1028564299 7:92211186-92211208 TCCAAAGGAAAGGAAATCAGTGG + Intronic
1028706416 7:93852869-93852891 TCCTTGGGGAAGCAGAGCAGTGG + Intronic
1028820823 7:95210070-95210092 TCAGTGGGAAAAAAGATCACTGG + Intronic
1029159497 7:98541485-98541507 GCCTTGGGAAAGGGGAACAGAGG - Intergenic
1031619025 7:123913658-123913680 TCCTTGGGAAAGAAAGTCAGAGG + Intergenic
1032019825 7:128401052-128401074 TCCATGGGGGAGGAGATCAGTGG + Exonic
1033096982 7:138440889-138440911 TCCATGGGGGAGGAGATCAGTGG - Intergenic
1035414932 7:158674976-158674998 TCAGGGGGAAAAAAGATCAGTGG + Intronic
1036223894 8:6942584-6942606 TCCTGGGGACAGGACATCAGGGG + Intergenic
1043625599 8:82254021-82254043 TCCATGGGAAAGAAGTTCACTGG - Intergenic
1044470071 8:92556503-92556525 TCCCTGGGAGAGGAGATTAGAGG + Intergenic
1047275244 8:123400765-123400787 TCCATGGAGGAGGAGATCAGCGG - Intronic
1050764069 9:9110681-9110703 TCTGTGGGCAGGGAGATAAGAGG - Intronic
1052941451 9:34134488-34134510 TCCATGGGGGAGGAGATCAGCGG + Intergenic
1057068522 9:92076318-92076340 TCCTTGGGCAATGGGATCAGAGG - Intronic
1058396821 9:104563507-104563529 TCTGGGGGAAAGGAGAGAAGAGG - Intergenic
1058606886 9:106732473-106732495 TCGGTGGGAAAGGCGATAACAGG - Intergenic
1061465817 9:130778620-130778642 TGCTTGGCAAAGGAGAGCAGAGG - Intronic
1185821507 X:3209170-3209192 TCCGTGGCAAAGGGCATCTGAGG - Intergenic
1185891847 X:3828812-3828834 TCAGTGTGGAAGAAGATCAGAGG - Intronic
1185896954 X:3867226-3867248 TCAGTGTGGAAGAAGATCAGAGG - Intergenic
1187068586 X:15865464-15865486 GCCTTGGGAAAGCAGAGCAGAGG + Intergenic
1189323859 X:40101482-40101504 TCCATGGGAAGGGAGATTGGTGG - Intronic
1189362082 X:40360515-40360537 TCCGTGGGAAAGGAGATCAGTGG + Intergenic
1189501235 X:41560977-41560999 GCAGTGGGAAAAGGGATCAGAGG + Intronic
1190559525 X:51673214-51673236 AATGAGGGAAAGGAGATCAGGGG + Intergenic
1190564766 X:51720107-51720129 AATGAGGGAAAGGAGATCAGGGG - Intergenic
1192278288 X:69655966-69655988 ATGGTGGGCAAGGAGATCAGTGG - Intronic
1193440677 X:81536406-81536428 TCCCAGGGAAAGGGGGTCAGGGG + Intergenic
1196207871 X:112961569-112961591 TCAGTGGGAATGGAGAACAGAGG + Intergenic
1197958023 X:131973976-131973998 ACTCTGGGAAAGGAGATCAATGG - Intergenic
1198401998 X:136277659-136277681 ACCCAGGGGAAGGAGATCAGAGG - Intergenic
1198402103 X:136278372-136278394 TCCTAGGGGAAGGAGGTCAGGGG - Intergenic
1199429353 X:147741295-147741317 GCCCTGGGAAAGGTGATGAGTGG - Intergenic
1201266335 Y:12210750-12210772 TCAGTGGGACAGGAGCTCAGAGG - Intergenic
1201904906 Y:19077855-19077877 TCACTGGGCAAGGAGAGCAGTGG + Intergenic