ID: 1189366799

View in Genome Browser
Species Human (GRCh38)
Location X:40395145-40395167
Sequence ACCAGAGATGTCCCCAGTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189366794_1189366799 2 Left 1189366794 X:40395120-40395142 CCCATGATTCCCTGGGAACCGTT No data
Right 1189366799 X:40395145-40395167 ACCAGAGATGTCCCCAGTTGAGG No data
1189366795_1189366799 1 Left 1189366795 X:40395121-40395143 CCATGATTCCCTGGGAACCGTTG No data
Right 1189366799 X:40395145-40395167 ACCAGAGATGTCCCCAGTTGAGG No data
1189366796_1189366799 -7 Left 1189366796 X:40395129-40395151 CCCTGGGAACCGTTGAACCAGAG No data
Right 1189366799 X:40395145-40395167 ACCAGAGATGTCCCCAGTTGAGG No data
1189366797_1189366799 -8 Left 1189366797 X:40395130-40395152 CCTGGGAACCGTTGAACCAGAGA No data
Right 1189366799 X:40395145-40395167 ACCAGAGATGTCCCCAGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189366799 Original CRISPR ACCAGAGATGTCCCCAGTTG AGG Intergenic
No off target data available for this crispr