ID: 1189367202

View in Genome Browser
Species Human (GRCh38)
Location X:40397937-40397959
Sequence AATCAGAAGCAGACAGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189367202_1189367207 13 Left 1189367202 X:40397937-40397959 CCCTCTTCTGTCTGCTTCTGATT No data
Right 1189367207 X:40397973-40397995 CTGACATCCTCCCTGGACATTGG No data
1189367202_1189367208 17 Left 1189367202 X:40397937-40397959 CCCTCTTCTGTCTGCTTCTGATT No data
Right 1189367208 X:40397977-40397999 CATCCTCCCTGGACATTGGTAGG No data
1189367202_1189367206 6 Left 1189367202 X:40397937-40397959 CCCTCTTCTGTCTGCTTCTGATT No data
Right 1189367206 X:40397966-40397988 TCAGGATCTGACATCCTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189367202 Original CRISPR AATCAGAAGCAGACAGAAGA GGG (reversed) Intergenic
No off target data available for this crispr