ID: 1189371849

View in Genome Browser
Species Human (GRCh38)
Location X:40434960-40434982
Sequence GCTATGCGCCACCAGGATTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189371843_1189371849 1 Left 1189371843 X:40434936-40434958 CCTGTCCAAGGAAGTGGGTGGGG No data
Right 1189371849 X:40434960-40434982 GCTATGCGCCACCAGGATTGCGG No data
1189371841_1189371849 2 Left 1189371841 X:40434935-40434957 CCCTGTCCAAGGAAGTGGGTGGG No data
Right 1189371849 X:40434960-40434982 GCTATGCGCCACCAGGATTGCGG No data
1189371847_1189371849 -4 Left 1189371847 X:40434941-40434963 CCAAGGAAGTGGGTGGGGGGCTA No data
Right 1189371849 X:40434960-40434982 GCTATGCGCCACCAGGATTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189371849 Original CRISPR GCTATGCGCCACCAGGATTG CGG Intergenic
No off target data available for this crispr