ID: 1189373071

View in Genome Browser
Species Human (GRCh38)
Location X:40445408-40445430
Sequence CAGCCTCCCCACCATGCCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189373067_1189373071 -2 Left 1189373067 X:40445387-40445409 CCTCGGGGCTAAGACCTCTCCCA No data
Right 1189373071 X:40445408-40445430 CAGCCTCCCCACCATGCCCTAGG No data
1189373061_1189373071 18 Left 1189373061 X:40445367-40445389 CCTGACATGGGCATTCTTCCCCT No data
Right 1189373071 X:40445408-40445430 CAGCCTCCCCACCATGCCCTAGG No data
1189373066_1189373071 -1 Left 1189373066 X:40445386-40445408 CCCTCGGGGCTAAGACCTCTCCC No data
Right 1189373071 X:40445408-40445430 CAGCCTCCCCACCATGCCCTAGG No data
1189373058_1189373071 27 Left 1189373058 X:40445358-40445380 CCTGCCTTCCCTGACATGGGCAT No data
Right 1189373071 X:40445408-40445430 CAGCCTCCCCACCATGCCCTAGG No data
1189373060_1189373071 19 Left 1189373060 X:40445366-40445388 CCCTGACATGGGCATTCTTCCCC No data
Right 1189373071 X:40445408-40445430 CAGCCTCCCCACCATGCCCTAGG No data
1189373065_1189373071 0 Left 1189373065 X:40445385-40445407 CCCCTCGGGGCTAAGACCTCTCC No data
Right 1189373071 X:40445408-40445430 CAGCCTCCCCACCATGCCCTAGG No data
1189373059_1189373071 23 Left 1189373059 X:40445362-40445384 CCTTCCCTGACATGGGCATTCTT No data
Right 1189373071 X:40445408-40445430 CAGCCTCCCCACCATGCCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189373071 Original CRISPR CAGCCTCCCCACCATGCCCT AGG Intergenic
No off target data available for this crispr