ID: 1189375588

View in Genome Browser
Species Human (GRCh38)
Location X:40464103-40464125
Sequence CTTTGTGAGGCCAAGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 270574
Summary {0: 8, 1: 1404, 2: 26762, 3: 81732, 4: 160668}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189375588_1189375593 11 Left 1189375588 X:40464103-40464125 CCATCCACCTTGGCCTCACAAAG 0: 8
1: 1404
2: 26762
3: 81732
4: 160668
Right 1189375593 X:40464137-40464159 CAAGTGTGAGCTACCACACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189375588 Original CRISPR CTTTGTGAGGCCAAGGTGGA TGG (reversed) Intergenic
Too many off-targets to display for this crispr