ID: 1189377031

View in Genome Browser
Species Human (GRCh38)
Location X:40474372-40474394
Sequence AACACAAGCCAGCCTCCGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189377031_1189377033 -6 Left 1189377031 X:40474372-40474394 CCTGGCGGAGGCTGGCTTGTGTT No data
Right 1189377033 X:40474389-40474411 TGTGTTCACAGCCGCCTGCCGGG No data
1189377031_1189377032 -7 Left 1189377031 X:40474372-40474394 CCTGGCGGAGGCTGGCTTGTGTT No data
Right 1189377032 X:40474388-40474410 TTGTGTTCACAGCCGCCTGCCGG No data
1189377031_1189377038 19 Left 1189377031 X:40474372-40474394 CCTGGCGGAGGCTGGCTTGTGTT No data
Right 1189377038 X:40474414-40474436 CTGGAGCCTGTCAGCTCGAGCGG No data
1189377031_1189377040 27 Left 1189377031 X:40474372-40474394 CCTGGCGGAGGCTGGCTTGTGTT No data
Right 1189377040 X:40474422-40474444 TGTCAGCTCGAGCGGCAGCGAGG No data
1189377031_1189377041 28 Left 1189377031 X:40474372-40474394 CCTGGCGGAGGCTGGCTTGTGTT No data
Right 1189377041 X:40474423-40474445 GTCAGCTCGAGCGGCAGCGAGGG No data
1189377031_1189377034 0 Left 1189377031 X:40474372-40474394 CCTGGCGGAGGCTGGCTTGTGTT No data
Right 1189377034 X:40474395-40474417 CACAGCCGCCTGCCGGGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189377031 Original CRISPR AACACAAGCCAGCCTCCGCC AGG (reversed) Intergenic
No off target data available for this crispr