ID: 1189377518

View in Genome Browser
Species Human (GRCh38)
Location X:40477084-40477106
Sequence CTGTAAACACAGATACACTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189377518_1189377524 15 Left 1189377518 X:40477084-40477106 CCCTAGTGTATCTGTGTTTACAG No data
Right 1189377524 X:40477122-40477144 ACCACGTGAAGCCAGATTAGGGG No data
1189377518_1189377522 13 Left 1189377518 X:40477084-40477106 CCCTAGTGTATCTGTGTTTACAG No data
Right 1189377522 X:40477120-40477142 ACACCACGTGAAGCCAGATTAGG No data
1189377518_1189377523 14 Left 1189377518 X:40477084-40477106 CCCTAGTGTATCTGTGTTTACAG No data
Right 1189377523 X:40477121-40477143 CACCACGTGAAGCCAGATTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189377518 Original CRISPR CTGTAAACACAGATACACTA GGG (reversed) Intergenic
No off target data available for this crispr