ID: 1189377949

View in Genome Browser
Species Human (GRCh38)
Location X:40480484-40480506
Sequence TAGGAGATAGAAACTGATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189377941_1189377949 9 Left 1189377941 X:40480452-40480474 CCAAGTGGGTCAGAGGGTGGTTG No data
Right 1189377949 X:40480484-40480506 TAGGAGATAGAAACTGATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189377949 Original CRISPR TAGGAGATAGAAACTGATCA GGG Intergenic
No off target data available for this crispr