ID: 1189380138

View in Genome Browser
Species Human (GRCh38)
Location X:40496874-40496896
Sequence TGTGCTTAAAAACCCACTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189380138_1189380141 8 Left 1189380138 X:40496874-40496896 CCGGCAGTGGGTTTTTAAGCACA No data
Right 1189380141 X:40496905-40496927 TATTGATGGTTTCCTGGCTCCGG No data
1189380138_1189380139 -6 Left 1189380138 X:40496874-40496896 CCGGCAGTGGGTTTTTAAGCACA No data
Right 1189380139 X:40496891-40496913 AGCACAGCTGTTTCTATTGATGG No data
1189380138_1189380142 9 Left 1189380138 X:40496874-40496896 CCGGCAGTGGGTTTTTAAGCACA No data
Right 1189380142 X:40496906-40496928 ATTGATGGTTTCCTGGCTCCGGG No data
1189380138_1189380140 2 Left 1189380138 X:40496874-40496896 CCGGCAGTGGGTTTTTAAGCACA No data
Right 1189380140 X:40496899-40496921 TGTTTCTATTGATGGTTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189380138 Original CRISPR TGTGCTTAAAAACCCACTGC CGG (reversed) Intergenic