ID: 1189383575

View in Genome Browser
Species Human (GRCh38)
Location X:40518919-40518941
Sequence AAGCGTGGCCAGGGCTTTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189383575_1189383581 -7 Left 1189383575 X:40518919-40518941 CCCTGAAAGCCCTGGCCACGCTT No data
Right 1189383581 X:40518935-40518957 CACGCTTCACCATGGCAGCGAGG No data
1189383575_1189383586 21 Left 1189383575 X:40518919-40518941 CCCTGAAAGCCCTGGCCACGCTT No data
Right 1189383586 X:40518963-40518985 TCACAGGCCAGCAGCTCAACAGG No data
1189383575_1189383583 5 Left 1189383575 X:40518919-40518941 CCCTGAAAGCCCTGGCCACGCTT No data
Right 1189383583 X:40518947-40518969 TGGCAGCGAGGACCCTTCACAGG No data
1189383575_1189383588 28 Left 1189383575 X:40518919-40518941 CCCTGAAAGCCCTGGCCACGCTT No data
Right 1189383588 X:40518970-40518992 CCAGCAGCTCAACAGGCAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189383575 Original CRISPR AAGCGTGGCCAGGGCTTTCA GGG (reversed) Intergenic
No off target data available for this crispr