ID: 1189385108

View in Genome Browser
Species Human (GRCh38)
Location X:40530890-40530912
Sequence TTTCCTCTTTTTCCTAGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189385105_1189385108 19 Left 1189385105 X:40530848-40530870 CCTGCTGGAATTTAAAACCACTT No data
Right 1189385108 X:40530890-40530912 TTTCCTCTTTTTCCTAGAGCTGG No data
1189385103_1189385108 23 Left 1189385103 X:40530844-40530866 CCCTCCTGCTGGAATTTAAAACC No data
Right 1189385108 X:40530890-40530912 TTTCCTCTTTTTCCTAGAGCTGG No data
1189385104_1189385108 22 Left 1189385104 X:40530845-40530867 CCTCCTGCTGGAATTTAAAACCA No data
Right 1189385108 X:40530890-40530912 TTTCCTCTTTTTCCTAGAGCTGG No data
1189385107_1189385108 -4 Left 1189385107 X:40530871-40530893 CCTCACTTGATGATTTTTTTTTC No data
Right 1189385108 X:40530890-40530912 TTTCCTCTTTTTCCTAGAGCTGG No data
1189385106_1189385108 2 Left 1189385106 X:40530865-40530887 CCACTTCCTCACTTGATGATTTT No data
Right 1189385108 X:40530890-40530912 TTTCCTCTTTTTCCTAGAGCTGG No data
1189385102_1189385108 30 Left 1189385102 X:40530837-40530859 CCTTAATCCCTCCTGCTGGAATT No data
Right 1189385108 X:40530890-40530912 TTTCCTCTTTTTCCTAGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189385108 Original CRISPR TTTCCTCTTTTTCCTAGAGC TGG Intergenic
No off target data available for this crispr