ID: 1189387769

View in Genome Browser
Species Human (GRCh38)
Location X:40551320-40551342
Sequence TGCACATTGTTAGGTGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189387769_1189387773 -4 Left 1189387769 X:40551320-40551342 CCAGCAGCACCTAACAATGTGCA No data
Right 1189387773 X:40551339-40551361 TGCAAATCACAGCCTTGGTTGGG No data
1189387769_1189387771 -9 Left 1189387769 X:40551320-40551342 CCAGCAGCACCTAACAATGTGCA No data
Right 1189387771 X:40551334-40551356 CAATGTGCAAATCACAGCCTTGG No data
1189387769_1189387772 -5 Left 1189387769 X:40551320-40551342 CCAGCAGCACCTAACAATGTGCA No data
Right 1189387772 X:40551338-40551360 GTGCAAATCACAGCCTTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189387769 Original CRISPR TGCACATTGTTAGGTGCTGC TGG (reversed) Intergenic
No off target data available for this crispr