ID: 1189388118

View in Genome Browser
Species Human (GRCh38)
Location X:40554196-40554218
Sequence GTGCAGAACGAGCCTCCAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189388112_1189388118 22 Left 1189388112 X:40554151-40554173 CCAGGTACCCACGGCTCACCTGG No data
Right 1189388118 X:40554196-40554218 GTGCAGAACGAGCCTCCAGCGGG No data
1189388114_1189388118 15 Left 1189388114 X:40554158-40554180 CCCACGGCTCACCTGGAGCATAC No data
Right 1189388118 X:40554196-40554218 GTGCAGAACGAGCCTCCAGCGGG No data
1189388116_1189388118 4 Left 1189388116 X:40554169-40554191 CCTGGAGCATACAGCATCTCACT No data
Right 1189388118 X:40554196-40554218 GTGCAGAACGAGCCTCCAGCGGG No data
1189388115_1189388118 14 Left 1189388115 X:40554159-40554181 CCACGGCTCACCTGGAGCATACA No data
Right 1189388118 X:40554196-40554218 GTGCAGAACGAGCCTCCAGCGGG No data
1189388111_1189388118 23 Left 1189388111 X:40554150-40554172 CCCAGGTACCCACGGCTCACCTG No data
Right 1189388118 X:40554196-40554218 GTGCAGAACGAGCCTCCAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189388118 Original CRISPR GTGCAGAACGAGCCTCCAGC GGG Intergenic
No off target data available for this crispr