ID: 1189391562

View in Genome Browser
Species Human (GRCh38)
Location X:40581000-40581022
Sequence GGCTGTCGCCCGTGTCCCGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 129}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189391557_1189391562 14 Left 1189391557 X:40580963-40580985 CCTGGACGAGTCCGAGCGCGTCA 0: 1
1: 0
2: 0
3: 0
4: 18
Right 1189391562 X:40581000-40581022 GGCTGTCGCCCGTGTCCCGCCGG 0: 1
1: 0
2: 0
3: 10
4: 129
1189391556_1189391562 21 Left 1189391556 X:40580956-40580978 CCGGGAGCCTGGACGAGTCCGAG 0: 1
1: 0
2: 2
3: 8
4: 103
Right 1189391562 X:40581000-40581022 GGCTGTCGCCCGTGTCCCGCCGG 0: 1
1: 0
2: 0
3: 10
4: 129
1189391555_1189391562 22 Left 1189391555 X:40580955-40580977 CCCGGGAGCCTGGACGAGTCCGA 0: 1
1: 0
2: 0
3: 4
4: 68
Right 1189391562 X:40581000-40581022 GGCTGTCGCCCGTGTCCCGCCGG 0: 1
1: 0
2: 0
3: 10
4: 129
1189391560_1189391562 -9 Left 1189391560 X:40580986-40581008 CCTCCTCACGCTGCGGCTGTCGC 0: 1
1: 0
2: 0
3: 8
4: 103
Right 1189391562 X:40581000-40581022 GGCTGTCGCCCGTGTCCCGCCGG 0: 1
1: 0
2: 0
3: 10
4: 129
1189391558_1189391562 3 Left 1189391558 X:40580974-40580996 CCGAGCGCGTCACCTCCTCACGC 0: 1
1: 0
2: 0
3: 6
4: 80
Right 1189391562 X:40581000-40581022 GGCTGTCGCCCGTGTCCCGCCGG 0: 1
1: 0
2: 0
3: 10
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189391562 Original CRISPR GGCTGTCGCCCGTGTCCCGC CGG Exonic
901035226 1:6332281-6332303 GGCTGTGGCCTGTGGACCGCAGG + Intronic
902448593 1:16483357-16483379 TGCTGTCGGTCTTGTCCCGCAGG + Intergenic
904063107 1:27726309-27726331 GGCTCCCGCACGTGCCCCGCCGG - Intronic
904831018 1:33306850-33306872 TGCTGTCGCCCGAGTTCTGCTGG - Exonic
905884989 1:41486958-41486980 GGCTGCTGCCCGAGCCCCGCAGG + Intergenic
919115533 1:193276179-193276201 GGGTGTCTCCCGTGTCCTGCAGG + Intergenic
922396182 1:225203051-225203073 GGCTGTCTCCCCAGTCCTGCAGG + Intronic
923458570 1:234187551-234187573 GGCTGTCTCCTGGGTCCTGCGGG - Intronic
1063458970 10:6203506-6203528 CGCTGTGGCCCTTGTCCCGGTGG + Intronic
1073425934 10:103455493-103455515 GGCCGTGGCCAGTGTCCCGTGGG + Exonic
1075724346 10:124603903-124603925 GGCTGGAGCCTGTGTCCCCCAGG + Intronic
1077413748 11:2415047-2415069 GGCCGACGCCCGTGTCCTCCAGG - Exonic
1078288458 11:9982723-9982745 GGGTGTCTCCCGAATCCCGCAGG - Intronic
1080672687 11:34395441-34395463 GGGTGTCTCCCATGTCCTGCAGG + Intergenic
1083072735 11:60003334-60003356 GGGTGTCTCCTGTGTCCTGCAGG - Intergenic
1085076688 11:73598006-73598028 CGCTCTCGCCCGTGTCCAGTAGG + Exonic
1089556707 11:119319239-119319261 GGCTGTCACTCCTGTCCTGCTGG - Intronic
1089937338 11:122377849-122377871 GGGTGTCTCCCGGGTCCTGCAGG - Intergenic
1093488879 12:19682024-19682046 GGGTGTCTCCCGGGTCCTGCAGG + Intronic
1093720445 12:22436737-22436759 GGGTGTCTCCCAGGTCCCGCAGG - Intronic
1094447521 12:30547170-30547192 GGGTGTCTCCCGGGTCCTGCAGG + Intergenic
1098500487 12:71186836-71186858 GGCTGTCTCCCAGGTCCTGCAGG - Intronic
1099477320 12:83122671-83122693 GGGTGTCTCCCGTGTCCTGCGGG + Intronic
1101290260 12:103361166-103361188 GGCTGTCTCCTGGGTCCTGCAGG - Intronic
1102027018 12:109719453-109719475 CCCTGTCGCCCGTGTCCCAGTGG + Intronic
1106978258 13:35247633-35247655 GGCTGTCTCCCAGGTCCTGCAGG + Intronic
1107655237 13:42586217-42586239 GGCTGTGGCCCTTGTCCTGATGG - Intronic
1109213698 13:59563725-59563747 GGTTGTCTCCCGGGTCCTGCAGG + Intergenic
1112035506 13:95493021-95493043 GGGTGTCTCCTGTGTCCTGCAGG + Intronic
1113784994 13:112997769-112997791 GCCTGAGGCCCGTGTCCAGCAGG - Intronic
1114525770 14:23366166-23366188 GGGGGTCGCGCGTGGCCCGCAGG + Intergenic
1115969682 14:38931922-38931944 GAGTGTCTCCCGGGTCCCGCAGG - Intergenic
1119147579 14:72331023-72331045 GGCTTTCGGCCGAGTCCCTCTGG + Intronic
1123932302 15:25177781-25177803 GGCTGCAGCCCATGTCCCGCTGG + Intergenic
1123937765 15:25202274-25202296 GGGTGCAGCCTGTGTCCCGCTGG + Intergenic
1132764524 16:1527421-1527443 TGCTGTCCCCCGTGACCCACTGG - Intronic
1132934629 16:2474357-2474379 GGCTGTCGGCCCTGTCCCAGGGG + Intergenic
1142841174 17:2631693-2631715 GGGTGTCTCCCGGGTCCTGCAGG + Intronic
1143427757 17:6853768-6853790 GGGTGTCCCCCGGGTCCTGCAGG - Intergenic
1144872867 17:18381405-18381427 GGCTGCTGCCCGTCTCCTGCTGG - Exonic
1147150393 17:38510668-38510690 CGCTGTCGCCCGAGACCCGGCGG + Exonic
1149678716 17:58488518-58488540 GGCTCCTGCCCGGGTCCCGCAGG - Intergenic
1150538820 17:66075845-66075867 GGGTGTCTCCCGCGTCCTGCAGG - Intronic
1151748381 17:76023594-76023616 GGCTGCGGCCCGTCTCCTGCTGG + Exonic
1152600223 17:81258576-81258598 GGGTGTCGCCCTCGTCCAGCAGG - Intronic
1153400348 18:4678400-4678422 GGATGTCTCCCGGGTCCTGCAGG - Intergenic
1154218224 18:12431379-12431401 GGCCCTCGCCCGTGTCCCTTAGG + Exonic
1154356740 18:13627406-13627428 GGCTGTCACCTGTCTCTCGCTGG + Intronic
1157933448 18:51848417-51848439 GGGTGTCTCCCGGGTCCTGCAGG + Intergenic
1160445653 18:78925177-78925199 GGCCGACGCCCGTGTCCCTGTGG - Intergenic
1160452221 18:78973722-78973744 GCCCGAGGCCCGTGTCCCGCTGG - Intergenic
1160864276 19:1250220-1250242 GCCTCTCGCCCCTGTCCCGGAGG + Exonic
1161000350 19:1907692-1907714 GGCTGGCGGCCGTGTTCTGCTGG + Intronic
1163157195 19:15445965-15445987 GGCAGGTGCCCGTGTCCCGGAGG + Intronic
1164237721 19:23351764-23351786 GGGTGTCTCCCGGGTCCTGCAGG - Intronic
1165223973 19:34341086-34341108 GGCTGTAGCCCCTGTCCTCCAGG + Intronic
1166262802 19:41653164-41653186 GGCTGTCTCCTGGGTCCTGCCGG - Intronic
925127468 2:1469812-1469834 GGGTGTCTCCCGAGTCCTGCAGG + Intronic
925479274 2:4251660-4251682 GGGTGTCTCCCGAGTCCTGCAGG + Intergenic
926101697 2:10122402-10122424 GGCTGCGGCCCTGGTCCCGCGGG + Exonic
927328339 2:21832521-21832543 GGGTGTCTCCCGGGTCCTGCAGG + Intergenic
930730506 2:54723944-54723966 TGCTGTCCCCCGGGTCCCTCGGG + Intronic
932270245 2:70403106-70403128 GGGTGTCTCCCGGGTCCTGCAGG - Intergenic
935746421 2:106193824-106193846 CGCTGTCGTCCATGTCGCGCTGG - Intronic
941627307 2:167844387-167844409 GGATGTCTCCCGAGTCCTGCAGG - Intergenic
943891370 2:193290590-193290612 GGGTGTCTCCCGGGTCCTGCAGG + Intergenic
945536771 2:211026834-211026856 GGCTGTCTCCTGGGGCCCGCAGG + Intergenic
948531074 2:238606044-238606066 GGCTGTCTCCCAGATCCCGCAGG - Intergenic
1170863292 20:20128534-20128556 GGCTGTCTCCCGGGTTCTGCAGG + Intronic
1172954797 20:38748545-38748567 GGCAGTGGCCCGTGTGCCACCGG - Exonic
1175971565 20:62689213-62689235 GGCTGTGCCCCGTGCCTCGCAGG + Intergenic
1175971585 20:62689281-62689303 GGCTGTGCCCCGTGCCTCGCAGG + Intergenic
1175971595 20:62689313-62689335 GGCTGTGCCCCGTGCCTCGCAGG + Intergenic
1175995827 20:62811966-62811988 GGCTGTACCCCGAGTCCCCCTGG - Intronic
1177995478 21:28090629-28090651 GGGTGTCTCCCGGGTCCTGCAGG + Intergenic
1182682861 22:32096013-32096035 GGCTGTCTCCTGGGTCCTGCAGG + Intronic
1183720339 22:39558440-39558462 AGCTGGTGCCCGTGTCCGGCGGG + Intergenic
1184337478 22:43862284-43862306 GGCTGCCGCCCTTCTGCCGCGGG - Exonic
1185270992 22:49929304-49929326 CCCCGTCCCCCGTGTCCCGCGGG - Intergenic
950084604 3:10248587-10248609 GGCTGCCGCAGCTGTCCCGCCGG - Exonic
962999403 3:140664188-140664210 GGCTGTCTCCTGGGTCCTGCAGG - Intergenic
966992139 3:185243211-185243233 GGATGTCTCCTGTGTCCTGCAGG + Intronic
969496922 4:7531508-7531530 GGCTGTCCCCCTTTTCCCCCAGG + Exonic
975020077 4:69475058-69475080 GGCTGTCTCCTGGGTCCTGCTGG + Intergenic
978316893 4:107448069-107448091 GGGTGTCTCCCGAGTCCAGCAGG + Intergenic
979498555 4:121412007-121412029 GGGTGTCGCTCGGGTCCTGCAGG + Intergenic
980506646 4:133732425-133732447 GTCTGTGGCCCATGTCCAGCAGG - Intergenic
981460977 4:145013725-145013747 GGCTGTCTCCTGGGTCCTGCAGG - Intronic
984778391 4:183504217-183504239 GGCTGCCGCCCGCCTCCTGCCGG - Intergenic
988902096 5:35744937-35744959 GGGTGTCTCCCAGGTCCCGCAGG - Intronic
993916921 5:93755523-93755545 GGCTGTCTCCCAGGTCCTGCAGG - Intronic
996289072 5:121829699-121829721 GGGTGTCTCCCGGGTCCTGCAGG + Intergenic
1000758034 5:165184823-165184845 GGGTGTCTCCCGGGTCCTGCAGG + Intergenic
1002103421 5:176868479-176868501 GGCTGTGTCCCTTGTCCTGCAGG - Intronic
1002281150 5:178130851-178130873 GGCCGCCGCCCGGTTCCCGCGGG + Intergenic
1002817298 6:692962-692984 AGCTGACGTCCATGTCCCGCTGG + Intronic
1003063014 6:2877024-2877046 GGGTGTCTCCCGGGTCCTGCAGG - Intergenic
1003876925 6:10445975-10445997 GGGTGTCACCCTTGTCCCCCAGG - Intergenic
1004426954 6:15513217-15513239 GGCCGTCTCCCGTGTCTGGCAGG + Exonic
1005587993 6:27295721-27295743 GGCAGTCGCTCGAGTCCTGCTGG + Intronic
1008775530 6:55032673-55032695 GGGTGTCTCCCGGGTCCTGCAGG + Intergenic
1008992372 6:57618483-57618505 GGGTGTCTCCCGGGTCCTGCAGG - Intronic
1013111774 6:107070146-107070168 GGCTGTCCTCCATTTCCCGCTGG + Exonic
1013454295 6:110316144-110316166 GGCTGTTGCCCTTCTCCCCCAGG - Intronic
1013852759 6:114535279-114535301 GGGTGTCTCCTGTGTCCTGCAGG + Intergenic
1016384833 6:143520396-143520418 GGCTGTCTCCTGGGTCCTGCAGG - Intergenic
1018707530 6:166474005-166474027 GGGAGTCGCTCGTGTCCCACAGG + Intronic
1020213192 7:6170499-6170521 GGGTCACGCCCGGGTCCCGCTGG + Intronic
1020358689 7:7304141-7304163 GGGTGTCTCCCGGGTCCTGCAGG + Intergenic
1024400982 7:48924504-48924526 GGCTGGCGCCAGTGCCGCGCGGG - Intergenic
1029276537 7:99408507-99408529 GGCGGGCGCCGGTGGCCCGCAGG - Intronic
1031827853 7:126588770-126588792 GGCTGTCTCCTGGGTCCTGCAGG - Intronic
1032530319 7:132614893-132614915 GAAGGTCGCCTGTGTCCCGCCGG + Intronic
1033622784 7:143077351-143077373 GGCTGTCTCCTGGGTCCTGCAGG - Intergenic
1034683321 7:152947675-152947697 GGGTGTCTCCCGGGTCCTGCAGG + Intergenic
1035471481 7:159112638-159112660 GGCTCTCGGCCGGGTCCCGTCGG - Intronic
1035713118 8:1733648-1733670 GGCTGTGGCCTGTGTACCGCCGG - Intergenic
1037820095 8:22131189-22131211 GGCAGGCGCCCGGGTGCCGCGGG - Exonic
1038236957 8:25768844-25768866 GGGTGTCTCCTGGGTCCCGCAGG - Intergenic
1055126122 9:72719541-72719563 GGCTGTCTCCCAAGTCCTGCAGG + Intronic
1055347113 9:75350698-75350720 GGGTGTCTCCCGGGTCCTGCAGG + Intergenic
1057271280 9:93653051-93653073 AGCTGTGACCCGTGGCCCGCAGG + Intronic
1061509780 9:131053299-131053321 GGCTGTGGGCTGTGTCCAGCGGG - Intronic
1062690396 9:137838427-137838449 AGCTGTCGCCCGTGTCAGGCGGG - Intronic
1189391562 X:40581000-40581022 GGCTGTCGCCCGTGTCCCGCCGG + Exonic
1189600253 X:42616144-42616166 GGCTGTCTCCCAGGTCCTGCAGG + Intergenic
1189668202 X:43380416-43380438 GGCTGTCTCCTGTGTCCTGCAGG - Intergenic
1191045226 X:56129311-56129333 GGCTATCTCCCGGGTCCTGCAGG - Intergenic
1191151939 X:57228496-57228518 GGTTGTCTCCCGTGTCCTGCAGG + Intergenic
1191914559 X:66187642-66187664 GGGTGTCTCCCGGGTCCTGCAGG + Intronic
1193077863 X:77374671-77374693 GGCTGTCTCCCAGGTCCTGCAGG - Intergenic
1194165250 X:90507465-90507487 GGCTGTCTCCCATGTCCTGCAGG - Intergenic
1194299217 X:92163686-92163708 GGCTGTCTCCCGGCTCCTGCAGG + Intronic
1194927041 X:99837206-99837228 GGGTGTCTCCCGGGTCCTGCAGG + Intergenic
1195985252 X:110622173-110622195 GGCTGTCTCCTGGGTCCTGCAGG + Intergenic
1199205996 X:145148864-145148886 GGCTGTCTCCCAGGTCCTGCAGG - Intergenic
1199521633 X:148741995-148742017 GGGTGTCTCCCGGGTCCTGCAGG + Intronic
1199913605 X:152315142-152315164 GGCTGTCTCCCGGGTCCTGCAGG - Intronic
1200511514 Y:4085275-4085297 GGCTGTCTCCCATGTCCTGCAGG - Intergenic
1200616821 Y:5388520-5388542 GGCTGTCTCCCGGCTCCTGCAGG + Intronic