ID: 1189391884

View in Genome Browser
Species Human (GRCh38)
Location X:40583341-40583363
Sequence GGCTGAGGAAAATTTCCCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 130}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189391875_1189391884 11 Left 1189391875 X:40583307-40583329 CCTAGAGGGAAGGACACTTAGCC 0: 1
1: 0
2: 0
3: 13
4: 119
Right 1189391884 X:40583341-40583363 GGCTGAGGAAAATTTCCCATGGG 0: 1
1: 0
2: 1
3: 14
4: 130
1189391881_1189391884 -10 Left 1189391881 X:40583328-40583350 CCCAGACTGGGGAGGCTGAGGAA 0: 1
1: 1
2: 20
3: 225
4: 2194
Right 1189391884 X:40583341-40583363 GGCTGAGGAAAATTTCCCATGGG 0: 1
1: 0
2: 1
3: 14
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189391884 Original CRISPR GGCTGAGGAAAATTTCCCAT GGG Intronic
905676044 1:39825838-39825860 ATCTGAGGGGAATTTCCCATGGG + Intergenic
909311337 1:74153880-74153902 ATCCAAGGAAAATTTCCCATGGG + Intronic
909382892 1:75020870-75020892 GGCTGATGAAAAATTCACAGTGG - Intergenic
910810879 1:91234970-91234992 AGCTGATCAAAATTTCACATGGG - Intergenic
913029823 1:114890251-114890273 GGGTGAGCAAAATTTCCTTTAGG + Intronic
913289787 1:117261550-117261572 GGCTGAGGAAACTTTCCTTTTGG - Intergenic
915286603 1:154857336-154857358 GGCTGAGGAAAGTCTCCTGTGGG - Intronic
917635835 1:176935105-176935127 GGATTTGGAAAATTTACCATAGG - Intronic
919616302 1:199813005-199813027 GGTCAAGGGAAATTTCCCATGGG - Intergenic
920333014 1:205225609-205225631 GGCTAATGAAAATTTGCCATTGG + Intergenic
922061094 1:222092646-222092668 GAATCAGGAAAATATCCCATGGG + Intergenic
923851744 1:237803643-237803665 GGAAGATGAAAATTTGCCATGGG - Intronic
1067301933 10:45020020-45020042 GGCTCAGGAAAAATCACCATGGG - Intergenic
1067432209 10:46252051-46252073 AGCTGAGGGAAACTTCCCACAGG + Intergenic
1067441021 10:46309293-46309315 AGCTGAGGGAAACTTCCCACAGG - Intronic
1070842149 10:79494766-79494788 GGGTGAGGCAAATATCCCTTTGG - Intergenic
1074164343 10:110861462-110861484 GCCTGGGGAAAACTTCTCATGGG + Intergenic
1076750016 10:132537813-132537835 GGCTGCGGGAACTTTCCCAGCGG + Exonic
1078825770 11:14929127-14929149 GGGTGAGAAATATTTCCTATAGG + Intronic
1080790607 11:35519489-35519511 GGATGATAAAAATTTACCATGGG + Intronic
1088789461 11:113211629-113211651 GGCTGAGGAAAGTTCTCCAGTGG + Intronic
1091803369 12:3339191-3339213 GAATGAGGAAATTTACCCATCGG + Intergenic
1093226000 12:16484359-16484381 GGCTTTGGAAATTTTCCCAGAGG + Intronic
1094152751 12:27303395-27303417 GGTTAAGGAAGATTTCCCAGTGG - Intronic
1107183217 13:37486378-37486400 GATTGAGGGAAATTTCCCTTTGG + Intergenic
1108178437 13:47818329-47818351 GCCTTAGGAATATTCCCCATAGG - Intergenic
1108834451 13:54524275-54524297 AGCTGAGGAAAGTTTCACATAGG + Intergenic
1109302351 13:60601976-60601998 GGCTGAGAAATTTTTCCCAAAGG - Intergenic
1111534920 13:89591086-89591108 GGCTGAAGACAACTTCACATGGG - Intergenic
1113751117 13:112777084-112777106 GGTCGAGGAAAATTTCCCTAAGG - Intronic
1115034046 14:28835989-28836011 GGCTGGAGAAAATTGCCCATGGG + Intergenic
1115504998 14:34085374-34085396 GGATGAAGAACATTTCCCAAAGG - Intronic
1115712530 14:36066731-36066753 GGCTCTGGAAAGTTTCCCATTGG + Intergenic
1116809706 14:49527361-49527383 GGTTGAGGAAGATTTCCCTAAGG + Intergenic
1121154428 14:91669595-91669617 GGCTGATGAAAATGAGCCATGGG - Intronic
1124901248 15:33824938-33824960 GGCTGAGTAAAATTTGGCAGTGG + Intronic
1125110752 15:36029812-36029834 GGCTGGGGAAACATTCCAATGGG + Intergenic
1126696404 15:51329585-51329607 GGATGAAGAAAGTTTCCCAGTGG + Intronic
1126826410 15:52553813-52553835 GCCTGAGGAAAAAGTCTCATTGG + Intronic
1126972710 15:54135390-54135412 GTTTAAGGAAAATTTACCATTGG - Intronic
1128368616 15:67023048-67023070 GGGTTAGGAGAGTTTCCCATAGG + Intergenic
1129125945 15:73441540-73441562 GGGTGAGAAAAATTTCCCGAGGG - Intergenic
1129224687 15:74162131-74162153 GGCTGAGGAAAAGTGCCCCAGGG + Intergenic
1129895986 15:79106267-79106289 GGAAGGGGAAAATGTCCCATTGG + Intergenic
1130836923 15:87660106-87660128 TGCTGAGAAAAATGTTCCATTGG - Intergenic
1134208772 16:12258878-12258900 GACTCAGGGAAATTTCCCAAGGG - Intronic
1134467745 16:14494426-14494448 GGCTCAGAAAAATTTCCCTAAGG + Intronic
1135520982 16:23178051-23178073 GGCTGTGGAAAGTATCACATAGG - Intergenic
1135742020 16:24984098-24984120 GTCAAAGGAAAATTTCCAATTGG + Intronic
1135864685 16:26090496-26090518 GGGTGCACAAAATTTCCCATGGG + Intronic
1136586605 16:31190322-31190344 GGCCGAGGAGGATTTCCCAGTGG + Exonic
1139035911 16:62946286-62946308 AGTTGAGGCAAATTTTCCATGGG - Intergenic
1140578421 16:76199993-76200015 GGATGAGGGATATATCCCATAGG + Intergenic
1140653216 16:77111272-77111294 GGCTGAGGTTAATGGCCCATTGG - Intergenic
1143186250 17:5012286-5012308 GGCTTAGGAAAACTTCCCGGAGG + Intronic
1144604691 17:16653969-16653991 GGGTGAGAAAAAATTCCAATTGG + Intergenic
1148702442 17:49597405-49597427 GAATGGGGAAAATTTTCCATAGG + Intergenic
1150476371 17:65478959-65478981 GGCTGGGGGATCTTTCCCATAGG - Intergenic
1150495610 17:65605824-65605846 TGCTTAGGAAAATTTCAAATAGG - Intronic
1151496951 17:74463609-74463631 GGCTGAGGCCCATTTCCCAGGGG - Intergenic
1156321695 18:36031398-36031420 GGCTAAGGAAGATTTCTCATAGG + Intronic
1160626470 18:80211301-80211323 GCCTGAGGAATAGTTACCATTGG + Intronic
1164442245 19:28288106-28288128 GCCTGAAGAAAACTTCCCAGGGG + Intergenic
1166607672 19:44159632-44159654 GGCTGATAAAAATTTGGCATTGG - Exonic
1168539269 19:57196954-57196976 GGCGAAGGGAAATTTCCCAGTGG - Intronic
929282797 2:40100713-40100735 CGCTGAGGACATTTTCTCATCGG - Intronic
939277221 2:140013853-140013875 GGCAAAGGCAAACTTCCCATTGG + Intergenic
939631183 2:144528255-144528277 GACTTAGGAAAAGCTCCCATGGG + Intergenic
944749182 2:202690538-202690560 GGTTGAGGAAGATTTTCCAGAGG + Intronic
948238196 2:236406412-236406434 GGCTGTGGAAAAATTCAAATAGG + Intronic
948772702 2:240259647-240259669 GGCTGCGAAAAACTTCCCATGGG - Intergenic
1169817535 20:9673779-9673801 GGCAAGGGAAAATTTCCCAGAGG - Intronic
1172374946 20:34431180-34431202 GGCTGAGGCAATCTTCCCCTTGG - Intronic
1173770116 20:45648926-45648948 GGCTGAGCCAAATGGCCCATGGG + Intronic
1181789732 22:25255684-25255706 AGTTGAGTAAAATTTCCCACTGG - Intergenic
1181824552 22:25504519-25504541 AGTTGAGTAAAATTTCCCACTGG - Intergenic
949509792 3:4758014-4758036 GGCTGAGGAAAATTCTCTGTGGG - Intronic
949610643 3:5699879-5699901 CCCTGAGCAAAATTTTCCATGGG - Intergenic
951281429 3:20754424-20754446 GGCTGATGAAAATTTCTCCCTGG + Intergenic
952720066 3:36523289-36523311 TGCTCAGTAAAATTTGCCATAGG - Intronic
959092303 3:101916840-101916862 AGCTGAGGAAAATTGCCCACTGG + Intergenic
959328244 3:104966586-104966608 GGATTAGAAAAATTTCACATAGG - Intergenic
961491427 3:127259147-127259169 TGCTCAGGAAAATTTGCCATTGG - Intergenic
962349022 3:134643411-134643433 GCCTGGGGAAAATTCCCCAGTGG - Intronic
962763280 3:138538035-138538057 GTCTGGGGAAAATTTTCCACAGG - Intronic
964184730 3:153929138-153929160 GGCAGTTGAAAATTTCCCAGAGG - Intergenic
965250038 3:166331374-166331396 GGCTGAAGAAAATTTCTTATTGG + Intergenic
965452836 3:168859298-168859320 GTCTATGGAAAATTTCCCCTCGG - Intergenic
967126880 3:186432124-186432146 GGCAGAGGAAACTGACCCATGGG + Intergenic
969952360 4:10851514-10851536 TGCTGAGGAATATTTTCCTTTGG + Intergenic
970039625 4:11781452-11781474 GGCTGTGGATGATTTTCCATAGG + Intergenic
973700467 4:53532606-53532628 GCATGAGGAGAATTTCCTATGGG - Intronic
974283577 4:59833326-59833348 GCAAGGGGAAAATTTCCCATTGG - Intergenic
976879024 4:89895505-89895527 GGCTGAGGTATGTTTCCCGTGGG - Exonic
980737826 4:136913976-136913998 GGCTGATGAAATTGCCCCATGGG - Intergenic
983191005 4:164753357-164753379 GGCTGAGGATAAATTCCACTTGG - Intergenic
983480823 4:168271397-168271419 GGCTGAGGTCATTTTTCCATTGG + Intronic
984291640 4:177802944-177802966 GGCTGAGGAAAATTAAGCAATGG - Intronic
986787753 5:11130536-11130558 GTCTGCTGAAAGTTTCCCATTGG + Intronic
990329065 5:54707492-54707514 GGCAAATGCAAATTTCCCATAGG - Intergenic
990709848 5:58568113-58568135 GGTTGGGAAAAACTTCCCATGGG + Intergenic
990798629 5:59573514-59573536 GGATGAGGAAAATTCGCCCTGGG - Intronic
999211564 5:149893973-149893995 TACTGAGGAAAGTTTCCAATGGG + Intronic
1005798247 6:29391051-29391073 GGCTGAGTAGACCTTCCCATGGG + Intronic
1006235670 6:32629499-32629521 GGATCAGGAAAAATTACCATTGG - Intronic
1007106807 6:39289009-39289031 GGCTAAGGGAAAGTTCCCCTTGG + Intergenic
1008063099 6:47019377-47019399 TGCTGTTGAAAATTTCCTATGGG + Intronic
1008856357 6:56093018-56093040 GGCAGAGGAAAATTTCACATAGG - Intronic
1008997710 6:57678273-57678295 GCCTCAAGAAAATTTCCCAGTGG + Intergenic
1011280779 6:85675279-85675301 GGCAGAGGAAAAATTCCTGTTGG + Intergenic
1012129304 6:95471077-95471099 GGTTGATGTAAATTACCCATAGG - Intergenic
1012780672 6:103552971-103552993 ATCTGAGGAAAATTTTCCTTTGG - Intergenic
1012964672 6:105660649-105660671 GGCTCATGAAAACTTCCCATAGG - Intergenic
1016117128 6:140301269-140301291 GGCTGAGGAAAAAGTCCGTTTGG - Intergenic
1021188030 7:17588131-17588153 GGCTAAGAAAAATTACCTATTGG + Intergenic
1024867332 7:53919104-53919126 TACTGAGGAAAATTCTCCATGGG - Intergenic
1027112994 7:75455640-75455662 GGCTGAGGACAGGTTCCCAGAGG - Intronic
1027285241 7:76640251-76640273 GGCTGAGGACAGGTTCCCAGAGG - Intergenic
1028705530 7:93840540-93840562 CCAAGAGGAAAATTTCCCATTGG - Intronic
1032927617 7:136626169-136626191 AGCTGAGGAAAATTTTTCAATGG - Intergenic
1032948736 7:136882723-136882745 GCCTGAGCAAAATTTCCTCTAGG + Intronic
1034636443 7:152571146-152571168 GGCTGAGCAAGGTTTCCCCTGGG + Intergenic
1034636452 7:152571195-152571217 GGCTGAGCAAGGTTTCCCCTGGG + Intergenic
1037235298 8:16713082-16713104 CCCTGAGGAAAATTTGACATAGG + Intergenic
1040088691 8:43372345-43372367 GGCTCAGGAAGATTTCCCTGGGG - Intergenic
1040405877 8:47101469-47101491 GGCTCAGGAAGATTTCCCTGGGG + Intergenic
1042557133 8:70043025-70043047 GGTTGAGGAAACTTTTCCAAAGG + Intergenic
1045658547 8:104411869-104411891 GCCTGAAGAAAATTTTCCATTGG - Intronic
1048226504 8:132592308-132592330 GGCTCAGGGAAATTTCCCGAGGG + Intronic
1049069857 8:140348003-140348025 GGCTGAGAAGAATTTGCCATCGG + Intronic
1049253055 8:141599334-141599356 GGCTGAGAAAGCTTTCCCCTGGG + Intergenic
1050720897 9:8587999-8588021 TTCTGAGGAGAATTGCCCATTGG - Intronic
1051559173 9:18420997-18421019 GGCTGAGGAAGAATTCAGATTGG + Intergenic
1051847664 9:21470678-21470700 GGCTCATGTAAATTTCTCATGGG + Intergenic
1059167790 9:112095596-112095618 AGCTGAGGGTAATTCCCCATGGG + Intronic
1059962228 9:119576680-119576702 GACTGAGGGAGATTTCCCAGAGG + Intergenic
1060726398 9:126008741-126008763 GGCTGAGGACAATTGCCCAGAGG + Intergenic
1187066342 X:15842658-15842680 GGGTAAGGAAAATTTTACATGGG + Intronic
1187802465 X:23079657-23079679 GGGTTAGGAAAAGCTCCCATAGG + Intergenic
1189391884 X:40583341-40583363 GGCTGAGGAAAATTTCCCATGGG + Intronic
1190437156 X:50437036-50437058 GTCAGAGGACAATTTCCCTTTGG - Intronic
1192175109 X:68880481-68880503 GCCTGAGGTACATTTACCATGGG + Intergenic
1195244581 X:102983842-102983864 GGCTTGGGACAAGTTCCCATTGG + Intergenic
1197181885 X:123545340-123545362 TGCTGATGAAAATTTAGCATAGG + Intergenic
1199101192 X:143802376-143802398 AGCTGAGGAAACTTTCTCAGTGG - Intergenic
1199828440 X:151524066-151524088 GGATGAGGTAAATTTACCTTAGG - Intergenic