ID: 1189395959

View in Genome Browser
Species Human (GRCh38)
Location X:40623142-40623164
Sequence CAATGTTCTGCGGGAATGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189395959_1189395963 -10 Left 1189395959 X:40623142-40623164 CCTTTCATTCCCGCAGAACATTG No data
Right 1189395963 X:40623155-40623177 CAGAACATTGGCATGTAGTCTGG No data
1189395959_1189395967 23 Left 1189395959 X:40623142-40623164 CCTTTCATTCCCGCAGAACATTG No data
Right 1189395967 X:40623188-40623210 AGCGGTTACATGAGGCGCGAGGG No data
1189395959_1189395965 15 Left 1189395959 X:40623142-40623164 CCTTTCATTCCCGCAGAACATTG No data
Right 1189395965 X:40623180-40623202 CACTTTACAGCGGTTACATGAGG No data
1189395959_1189395966 22 Left 1189395959 X:40623142-40623164 CCTTTCATTCCCGCAGAACATTG No data
Right 1189395966 X:40623187-40623209 CAGCGGTTACATGAGGCGCGAGG No data
1189395959_1189395964 5 Left 1189395959 X:40623142-40623164 CCTTTCATTCCCGCAGAACATTG No data
Right 1189395964 X:40623170-40623192 TAGTCTGGAGCACTTTACAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189395959 Original CRISPR CAATGTTCTGCGGGAATGAA AGG (reversed) Intergenic
No off target data available for this crispr