ID: 1189395963

View in Genome Browser
Species Human (GRCh38)
Location X:40623155-40623177
Sequence CAGAACATTGGCATGTAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189395959_1189395963 -10 Left 1189395959 X:40623142-40623164 CCTTTCATTCCCGCAGAACATTG No data
Right 1189395963 X:40623155-40623177 CAGAACATTGGCATGTAGTCTGG No data
1189395958_1189395963 -9 Left 1189395958 X:40623141-40623163 CCCTTTCATTCCCGCAGAACATT No data
Right 1189395963 X:40623155-40623177 CAGAACATTGGCATGTAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189395963 Original CRISPR CAGAACATTGGCATGTAGTC TGG Intergenic
No off target data available for this crispr