ID: 1189400057

View in Genome Browser
Species Human (GRCh38)
Location X:40659167-40659189
Sequence TTGAGGAGGTTAGAGTTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 206}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189400057 Original CRISPR TTGAGGAGGTTAGAGTTGGT GGG (reversed) Intronic
900564680 1:3326483-3326505 TTGAGGATGCCAGACTTGGTGGG + Intronic
900850687 1:5140507-5140529 ATGAGGATGTGAAAGTTGGTAGG - Intergenic
902551440 1:17222000-17222022 TGGAGGTGGTGAGAGGTGGTGGG + Intronic
903672720 1:25046073-25046095 TTGAGGAGGTGACAGCGGGTGGG + Intergenic
905717333 1:40162971-40162993 TTGATGAACTTACAGTTGGTGGG + Intronic
905992295 1:42348754-42348776 TTGAGGTGGTTTGAGGTTGTTGG - Intergenic
907664690 1:56424531-56424553 AGGAGGAGGGTAGAGTTGGGGGG - Intergenic
910280991 1:85501562-85501584 TTGAGGTGGTTGGAATTTGTAGG - Intronic
910759523 1:90720109-90720131 TTGAAGAGGGTAGAGTAGGTAGG - Intergenic
915261625 1:154680922-154680944 ATGAGGAAATTAAAGTTGGTGGG + Intergenic
916498902 1:165369701-165369723 TTGAGGAGCCAAGACTTGGTTGG - Intergenic
916898988 1:169200561-169200583 TAGAGGAGGTTGGAGTGGATGGG - Intronic
917750858 1:178052141-178052163 GTGAGAAGGTGAGAGGTGGTCGG - Intergenic
918428447 1:184434491-184434513 TTTAGGAACTTAGATTTGGTTGG + Intronic
919945208 1:202314257-202314279 TGGAGGAGGTAAGAGTAAGTGGG - Intronic
921531713 1:216291028-216291050 TGGAGAAGGTTAGAGTGGTTGGG - Intronic
922187934 1:223292968-223292990 TTGAGGAGGGAACAGTAGGTGGG + Intronic
922882236 1:228989752-228989774 TGGAGGAGGTTAGGGTGGGCTGG + Intergenic
923027576 1:230218153-230218175 TGGAGGTGGTGAGAGGTGGTTGG + Intronic
923158099 1:231296023-231296045 TTGAAGAGGTTAAGGTAGGTGGG - Intergenic
923578254 1:235181691-235181713 TTGAGGTGGATAGTGTTGCTGGG - Exonic
923917700 1:238528004-238528026 TTCAGAAGGTTATAGTTCGTGGG + Intergenic
924487744 1:244503055-244503077 TTGATGATGCTAGAGTTGATGGG + Intronic
924951239 1:248885594-248885616 TTAAGTGGGATAGAGTTGGTTGG - Intergenic
1064061916 10:12145065-12145087 TTGAGGAGGTGAGTGTGGGGTGG + Intronic
1064782282 10:18855980-18856002 TTGAGTAGGGTTGAGTTGGCAGG + Intergenic
1065982257 10:30911579-30911601 TTGAGGAGATGAGAATTTGTAGG - Intronic
1067263858 10:44719772-44719794 ATGAGGCAGTTAGAATTGGTGGG - Intergenic
1067834660 10:49631056-49631078 CTGAGGAGCTGAGCGTTGGTGGG - Intronic
1068129687 10:52882103-52882125 TAGAGATGGTTAGAGTTGGAAGG + Intergenic
1068203986 10:53823471-53823493 TTTAGTAGGTTAGTGTTGTTTGG - Intronic
1069739478 10:70678516-70678538 TTGAGCAGGCTAGTGATGGTTGG + Intronic
1070045947 10:72836694-72836716 TTAAGAAGGATAGTGTTGGTAGG - Intronic
1070377844 10:75851423-75851445 TTGATGAGTTTTGAGTTGGAAGG - Intronic
1070636675 10:78134254-78134276 TTGAAGAGGTCACAGTTGGATGG + Intergenic
1070647153 10:78209980-78210002 TTAAGGAGTTTAGAGTCTGTTGG + Intergenic
1072355344 10:94604617-94604639 TTGAAGTGGTGAGAGGTGGTAGG - Intronic
1074851513 10:117443020-117443042 TGGAGGAAGTGAGAGTTGATTGG + Intergenic
1074950050 10:118324746-118324768 TGGAGGAGGGTAGTGATGGTTGG + Intronic
1075648825 10:124114402-124114424 CTGAGTGGGTTAGAGTTGGAAGG + Intergenic
1075748769 10:124746538-124746560 TTAATCAGGTTAGCGTTGGTTGG - Intronic
1075772249 10:124949322-124949344 TTTAGGAGCTGAGATTTGGTTGG + Intronic
1075778965 10:125004912-125004934 TTGAGGAGGTTAGGGATGGAAGG - Intronic
1077499979 11:2904930-2904952 TGGAGGAGGTGAGAGGTGGCTGG + Intronic
1078614174 11:12849369-12849391 TTGCGGAGTTTAGAGATGGTGGG - Intronic
1082796635 11:57382624-57382646 GTGAGGAGGGGAGTGTTGGTTGG - Intergenic
1084116483 11:67045651-67045673 TTGGGGAGTTTGGAGTCGGTGGG + Intronic
1086837410 11:91641925-91641947 TTAATGAGGTAAGAGTTGGGTGG + Intergenic
1088901285 11:114119579-114119601 CAGAGAAGTTTAGAGTTGGTGGG + Intronic
1090967391 11:131610761-131610783 ATGAGGATGCTTGAGTTGGTGGG + Intronic
1091904906 12:4177469-4177491 TTGAGGTGGCTGGAGTTTGTGGG + Intergenic
1093420198 12:18966238-18966260 TTGAGGAGGTTGGAGGTCTTGGG - Intergenic
1093772003 12:23029112-23029134 TTGAAGAGGTTAAAGATTGTTGG + Intergenic
1096948876 12:55442463-55442485 TTGGGGAGGTGAGATATGGTTGG + Intergenic
1100335777 12:93627793-93627815 GGGAGGAGGTTAGAGTTAGAGGG - Intergenic
1100342182 12:93689885-93689907 TATAGAAGGTTAGAGTTGGAAGG + Intronic
1100735055 12:97519072-97519094 TTGAAGAGGTGAGATTTGGTTGG - Intergenic
1103654249 12:122457626-122457648 TTGAGGAGGTCAGTGGGGGTAGG + Intergenic
1105870002 13:24496231-24496253 TTGTGGAGGATATAGTTGTTTGG - Intronic
1106732076 13:32551826-32551848 CTGAGGAGGTCATAGTGGGTAGG + Intergenic
1107608459 13:42086885-42086907 TTGAGGAGGCTAGAATTTGTGGG + Intronic
1108303245 13:49102735-49102757 TTGAGGAGATTACAGTTTATAGG + Intronic
1109217870 13:59610561-59610583 TTCAACAGTTTAGAGTTGGTTGG - Intergenic
1111735668 13:92136033-92136055 TGGAAGAGGTGAGAGTTGGGTGG + Intronic
1112300566 13:98225928-98225950 TTGGGGAGGTCAGTGATGGTTGG + Intronic
1112378501 13:98865925-98865947 TTGAGGAGCTGGGAGTTGGCAGG + Intronic
1116574921 14:46561213-46561235 TTGAGAAGGATAGAATTAGTAGG + Intergenic
1116946590 14:50841034-50841056 ATGAGGTTGCTAGAGTTGGTTGG + Intergenic
1120092025 14:80343003-80343025 TTGTGGAGGTTACAGTTGAGTGG - Intronic
1120247814 14:82027038-82027060 GTGAGGACGTTAGATTTGGGAGG - Intergenic
1120811980 14:88812992-88813014 CTGAGGAGGTAAGATATGGTTGG + Intergenic
1121508141 14:94492045-94492067 TTGAGGAGGGGAGAGGTGGGAGG + Intronic
1122805771 14:104255811-104255833 TTAATGAGGATAGAGTTGTTGGG - Intergenic
1123675317 15:22705006-22705028 TGGAAGAGGTGAGAGTTGGGTGG + Intergenic
1124025852 15:25964844-25964866 TTGAGGGGGTTGGAGATGCTTGG - Intergenic
1124327309 15:28777957-28777979 TGGAAGAGGTGAGAGTTGGGTGG + Intergenic
1128470241 15:67945775-67945797 TTGAGGAAGTCACAGTAGGTAGG + Intergenic
1129779960 15:78264011-78264033 TTTAGGGGGTTGGAGTGGGTAGG - Intergenic
1129853248 15:78807169-78807191 TTGAGAATTTTAGAGCTGGTTGG - Intronic
1131961456 15:97793867-97793889 TTGAGGTGGGAAGAATTGGTGGG - Intergenic
1132207450 15:99995994-99996016 TTGATGATGTCAGACTTGGTGGG + Intronic
1133247696 16:4460192-4460214 TTGAGGAGCTTATATTTAGTGGG - Intergenic
1133840091 16:9400070-9400092 TTCAGGAGGTAAGAATTGTTGGG + Intergenic
1135499348 16:22980313-22980335 TGGAGAAGGTTAGAAGTGGTAGG + Intergenic
1137668416 16:50265557-50265579 TTGAGGAGGGCAGAGATGGGAGG - Intronic
1138869085 16:60859212-60859234 TTGGGGAAGTTACAGTTGGAAGG - Intergenic
1140230942 16:73116603-73116625 TTCAGGATGTTGGAGTGGGTTGG + Intergenic
1140573640 16:76138042-76138064 TTGAGGATTTTAAAGTTGGGGGG + Intergenic
1140621248 16:76735979-76736001 TTGGGCAGGTGGGAGTTGGTGGG - Intergenic
1142328495 16:89434193-89434215 TTGAGGAGGTGAGTGTGTGTAGG - Intronic
1143472681 17:7185730-7185752 TTGAGGAGGAGAGAGCTGGGGGG - Intergenic
1143763328 17:9120696-9120718 TTGATGTGGGCAGAGTTGGTGGG + Intronic
1147638416 17:41978491-41978513 GTGAGGAGGTTGGGGTTGGAGGG - Intronic
1148587087 17:48788602-48788624 TCGAGGAGTTTAGAGATGGCAGG + Intronic
1149429600 17:56587106-56587128 TTGAGGAGGTCACAGATGATTGG - Intergenic
1151157752 17:72138468-72138490 TTGAGGAGGGTTGGGTTGGGGGG + Intergenic
1151195631 17:72429589-72429611 ATGCGGGGGTTGGAGTTGGTGGG - Intergenic
1156047085 18:32889026-32889048 GTGAGGAGGTGAGAGGTGGGTGG + Intergenic
1156467403 18:37356527-37356549 CTGGGGAGGTTAGAGGTGCTGGG + Intronic
1161285804 19:3467700-3467722 TTGGGGAGGCCAGAGTGGGTAGG - Intronic
1161603888 19:5203735-5203757 TTGAGAATGTTAGAGTAGGAGGG + Intronic
1161862463 19:6808336-6808358 TTGGGGAGGAGAGAATTGGTTGG - Intronic
1162049107 19:8021526-8021548 TGGATGAGGTCAGAGTTGGAGGG + Intronic
1162079973 19:8211993-8212015 TGGAGGAGGTGACAGTTGGCTGG + Intronic
1163619171 19:18348019-18348041 TTCAGGAGGTGGGAGTTGGTGGG + Intronic
1167575201 19:50314624-50314646 TTGGGGAGGGAAGAGTTGGGGGG + Intronic
1167601933 19:50459543-50459565 GAGAGGAGGTGAGAGATGGTGGG + Intronic
1167601938 19:50459565-50459587 GAGAGGAGGTGAGAGATGGTGGG + Intronic
1167631383 19:50628249-50628271 TTGAGGATCTGAGATTTGGTGGG + Intronic
927159757 2:20245759-20245781 TTGTGGAGGTCAGAGTAGCTCGG - Intergenic
928467155 2:31532879-31532901 TTGAGGAGGTGCAAATTGGTAGG + Intronic
930682727 2:54274336-54274358 TTGTGGAGATGAGATTTGGTAGG + Intronic
930747938 2:54903982-54904004 TGGAGGAGGTAGGAGTAGGTTGG - Intronic
932969574 2:76524066-76524088 TTGTGTAGGTTATAGCTGGTAGG - Intergenic
933245223 2:79967415-79967437 TTGAGGAGGTGAAACTTGTTGGG - Intronic
934562399 2:95320100-95320122 GTGAGGAGGCTAGAGCTGGCTGG + Intronic
935903306 2:107815658-107815680 TGAAGGAGTTTAGACTTGGTGGG - Intergenic
936963883 2:118106498-118106520 TTGGAGGGGTTACAGTTGGTAGG + Intronic
937110429 2:119363031-119363053 TGAGGGAGGTGAGAGTTGGTGGG - Intronic
937450258 2:121996371-121996393 CAGAGGAGGCAAGAGTTGGTGGG + Intergenic
937713906 2:125010272-125010294 TTGAGAAGGTTGGAGCTGGAGGG + Intergenic
938026323 2:127952034-127952056 TTGAGGAGGCGAGAGTGGGTGGG - Intronic
941752352 2:169146582-169146604 TTCAGCAGGTGGGAGTTGGTGGG + Intronic
943766598 2:191669671-191669693 TTGAGTAGGTGAGAGATGATGGG - Intergenic
945499519 2:210553780-210553802 TTGAGGCTATAAGAGTTGGTTGG - Intronic
947286299 2:228519146-228519168 TTCAGGAGTTTAGAGTGAGTAGG - Intergenic
948836802 2:240629809-240629831 TTGAGGAGTTTTGTGTTTGTGGG + Intronic
949038795 2:241835099-241835121 TTTAGAGGGTTAGAGTTGGAGGG + Intergenic
1169596854 20:7210154-7210176 TGGAAGTGGTTAGATTTGGTTGG + Intergenic
1173786796 20:45799727-45799749 TTGTGGAGCTTATAGTTTGTGGG - Intronic
1175216494 20:57394088-57394110 TTGATGGGGTTGGAGTTGGAGGG + Intronic
1183218522 22:36496803-36496825 TAGAGCAGGTGAGAGCTGGTTGG + Intronic
949464298 3:4328701-4328723 GTGAGGACGTGAGATTTGGTAGG - Intronic
950215062 3:11153512-11153534 TTGAGGAGGTGGGACATGGTGGG - Intronic
950580565 3:13859255-13859277 TGGAGGAGGTTGGAGACGGTGGG - Intronic
954166497 3:48763201-48763223 CTGAGGATGTTAGAATTGTTAGG - Intronic
955509658 3:59666600-59666622 TTGAGGAGGTTATATTGTGTAGG - Intergenic
955868442 3:63410832-63410854 TTGAGGAGGACAGTGATGGTTGG + Intronic
958424112 3:93961938-93961960 TTGAGGAGGAGAGAATAGGTAGG - Intronic
960660917 3:120057392-120057414 CTGATTAGGATAGAGTTGGTTGG - Intronic
960681024 3:120247614-120247636 TTGAGGTGGTTAGAATTTGTGGG + Intronic
961104673 3:124230890-124230912 CTCAGGATGTAAGAGTTGGTTGG - Intronic
962903127 3:139777878-139777900 TTGGGGAGGTTAGGGGAGGTGGG - Intergenic
963248229 3:143082644-143082666 TTGGGGAGGTCAGAGCTGGGGGG + Intergenic
964754000 3:160078265-160078287 TTGAAGAGGTTAAGGTAGGTGGG - Intergenic
965490765 3:169333214-169333236 TTGAGGAAGTTAGACATGATGGG + Intronic
966117114 3:176478298-176478320 TTGATCAGGTCAGAGCTGGTAGG + Intergenic
966556696 3:181269944-181269966 TTAAAGAGCTTAGAGTTAGTTGG + Intergenic
967499993 3:190186424-190186446 TGAAGGAGATTAGAGTGGGTGGG + Intergenic
968625193 4:1623853-1623875 TTGAGGAGGGTGGCGTTGATGGG + Intronic
970831136 4:20340962-20340984 ATGAGGAGGGTAGGGATGGTTGG + Intronic
972357295 4:38291979-38292001 GTGATGAGGTTAGGGATGGTAGG - Intergenic
974125976 4:57696188-57696210 TTTAGAATGTTAGAATTGGTAGG + Intergenic
975343954 4:73272978-73273000 TTGAAGAGGCTAGAGTTGGCAGG - Intergenic
975593246 4:76020963-76020985 TTCAGGAGATTACAGTTGGAAGG + Intronic
975621002 4:76296356-76296378 TTGAGGAGGTGACAGCTTGTAGG + Intronic
976744728 4:88391781-88391803 TAGAGGAGGATGGAGTTTGTGGG - Intronic
977369077 4:96111911-96111933 TTGAGGATGTATGAGTGGGTAGG + Intergenic
977554737 4:98477279-98477301 GAGAGGAGGTTTGAGCTGGTGGG + Intronic
978255721 4:106690662-106690684 TTGACGAGGTTGTAGTTGCTAGG + Intergenic
979061622 4:116068748-116068770 TTGTGGAGGGTAGGGGTGGTGGG - Intergenic
981188208 4:141830635-141830657 TTGAGGGGCTATGAGTTGGTTGG - Intergenic
981806107 4:148716796-148716818 TTAAGTAGGTTAGAGGTGGTGGG + Intergenic
981978218 4:150758473-150758495 TAGAGGAGGTAAGAAGTGGTAGG - Intronic
986947923 5:13047307-13047329 GTGAGGACGTAAGATTTGGTAGG - Intergenic
988599113 5:32623024-32623046 TTGGGGAGTTTTGAGTTGTTTGG + Intergenic
989524920 5:42442203-42442225 TTGAGGAGGACAGAGTAAGTTGG + Intronic
990162021 5:52951682-52951704 TTGAGGTCATTAGAGATGGTAGG - Intronic
993394961 5:87374628-87374650 TTTAGGAGGTTAAAGATGGTAGG + Intronic
993504124 5:88690972-88690994 TTGGGGAGGTTTGATTTGGCTGG + Intergenic
995314553 5:110753273-110753295 ATGAGGGGTTTAGAGTAGGTTGG + Intronic
995366128 5:111363290-111363312 TAGATGAGATTAGAATTGGTTGG - Intronic
995380447 5:111526006-111526028 TTGAGGAAGTAGTAGTTGGTTGG + Intergenic
995929173 5:117415363-117415385 TTGAGAATTTTAGAGTTGTTAGG + Intergenic
998882530 5:146658051-146658073 TTGAGAAGCTTAGAGGAGGTAGG + Intronic
1000507067 5:162134266-162134288 TTTAAGAGGATAGAATTGGTTGG + Intronic
1001747555 5:174103411-174103433 TGGAGCAGGTTTGAGTTGGGAGG + Intronic
1007917366 6:45573714-45573736 TTGAACAGGTTGGAGTTTGTAGG + Intronic
1011876381 6:91966736-91966758 GTGAGGACGTGAGATTTGGTAGG + Intergenic
1013057607 6:106599379-106599401 TTGAGGAGGTTTTAATTGGGAGG - Intronic
1015772936 6:136787347-136787369 CTGAAGAGCTCAGAGTTGGTGGG - Intronic
1018071285 6:160166765-160166787 TGGAGGAGATAAGAGTTGTTGGG + Intergenic
1020234719 7:6346893-6346915 TTGGGGAGTTTACAGTTGGACGG - Intronic
1022956345 7:35385108-35385130 CTGAGGAGGTGGGAGTTTGTGGG - Intergenic
1023352985 7:39338848-39338870 ATGAGAAAGGTAGAGTTGGTGGG - Intronic
1023968221 7:44974446-44974468 CTGGGGAGCTGAGAGTTGGTGGG + Intronic
1026495248 7:70896125-70896147 TTGAGGAGGTAGGGGGTGGTCGG + Intergenic
1027704469 7:81511129-81511151 GTGAGGAGATGAGATTTGGTGGG + Intergenic
1031475105 7:122211736-122211758 ATGAGCAAGATAGAGTTGGTTGG - Intergenic
1031635129 7:124093033-124093055 TAGAGGATGGTAGAGTTGGGTGG - Intergenic
1032953808 7:136947731-136947753 TTGAGAAGGCTAGTGTTGATGGG + Intronic
1034518698 7:151602232-151602254 TTTAGGATGTTAGATTTGGCAGG - Intronic
1037468957 8:19188434-19188456 TTGGGGATGTTGGAGGTGGTGGG + Intergenic
1037469217 8:19191041-19191063 TTGGGGATGTTGGAGATGGTGGG - Intergenic
1038052466 8:23826826-23826848 TTGCGGTGGTGAGGGTTGGTCGG - Intergenic
1038809823 8:30829042-30829064 TTGAGAAGGAAAGAGTTGGCAGG - Intergenic
1041361430 8:57058504-57058526 TGCTAGAGGTTAGAGTTGGTGGG - Intergenic
1041707430 8:60861133-60861155 TTGCAGAGTTTAGAGTTGGAAGG + Intronic
1042291729 8:67175993-67176015 TTGAGGAGGTTATATTTTGTTGG + Intronic
1042999802 8:74744145-74744167 TTGAGGAAGTCAGATTTGTTTGG + Intronic
1043866649 8:85382668-85382690 TTGTGGAGGAAAGTGTTGGTTGG - Intronic
1045809259 8:106202151-106202173 GTAAGGAGGATAGAGTTGGGTGG - Intergenic
1046401747 8:113713556-113713578 TTGAGCAAGTTAGATTTGTTTGG + Intergenic
1050730497 9:8703895-8703917 CGGAGGAGGGTAGAGTTGTTTGG - Intronic
1053261200 9:36666559-36666581 TTGAGAAGGTCACAATTGGTGGG - Intronic
1056767849 9:89455642-89455664 TAGAGGAAGTCAGAGTGGGTGGG - Intronic
1057326977 9:94074567-94074589 ATGAGGAGGAAAGAGGTGGTGGG - Intronic
1057487768 9:95499460-95499482 GTGGGCAGGTTAGAGTGGGTGGG + Intronic
1060116729 9:120947386-120947408 TTGAAGAGGTAAGAGTGGATAGG - Intergenic
1185530195 X:812133-812155 TGGAGGGGGTGAGAGTCGGTGGG + Intergenic
1186303561 X:8228016-8228038 TTGTGGAGGTGAGAGTTCATAGG + Intergenic
1187030174 X:15478699-15478721 TTAAGGAGGTTAAAGATGTTTGG - Intronic
1187968921 X:24640168-24640190 TTGAGGAGCCTATAGGTGGTAGG - Intronic
1189171624 X:38915031-38915053 TTGAGGAGGTAAGAGCTGATGGG + Intergenic
1189400057 X:40659167-40659189 TTGAGGAGGTTAGAGTTGGTGGG - Intronic
1198472215 X:136957722-136957744 TTGCAGAGGGTGGAGTTGGTGGG + Intergenic
1198798082 X:140420888-140420910 TTGATATGGTTGGAGTTGGTTGG + Intergenic
1199992105 X:152993201-152993223 TGGAAGGGGTTAGACTTGGTGGG - Intronic
1201850397 Y:18473588-18473610 TTGAGGAGGAGAGACTTAGTTGG + Intergenic
1201882921 Y:18846789-18846811 TTGAGGAGGAGAGACTTAGTTGG - Intergenic