ID: 1189403944

View in Genome Browser
Species Human (GRCh38)
Location X:40700612-40700634
Sequence AGTTTGTTAGAGTTGCTATA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 146}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189403943_1189403944 6 Left 1189403943 X:40700583-40700605 CCTTTGGAATTCTATTAATTTTA 0: 1
1: 0
2: 8
3: 71
4: 665
Right 1189403944 X:40700612-40700634 AGTTTGTTAGAGTTGCTATAAGG 0: 1
1: 0
2: 0
3: 19
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189403944 Original CRISPR AGTTTGTTAGAGTTGCTATA AGG Intronic
901943816 1:12684774-12684796 AGTCTGTTTGCATTGCTATAAGG + Intergenic
909306620 1:74088156-74088178 AGTTTCTGAGAGTTGACATATGG - Intronic
909730832 1:78887002-78887024 AGTTTGTGAGAGCTCCTATAGGG + Intergenic
911997932 1:104790625-104790647 ACTTTGTCAGATTTTCTATAAGG + Intergenic
918753812 1:188309885-188309907 AGGTTGCTAAAGTTGTTATAGGG - Intergenic
919452216 1:197786101-197786123 ATTTTGTTCTACTTGCTATAGGG + Intergenic
919526826 1:198664034-198664056 AGTATGTTAAAGATGCTATGGGG + Intronic
921811653 1:219521474-219521496 ATTTTGGTACAGATGCTATAAGG - Intergenic
922076150 1:222246946-222246968 ACTTTTTTAAAGTTGATATATGG - Intergenic
923216502 1:231852987-231853009 AATATTTTAGAGCTGCTATAAGG - Intronic
924221538 1:241880951-241880973 AGAATGTTAGAGTTTCTGTAAGG + Intronic
1067686416 10:48468633-48468655 AGTTTGTTAGAGCTGCAATGTGG + Intronic
1069783302 10:70970396-70970418 AGTCTGTTTGTATTGCTATAAGG - Intergenic
1070832436 10:79426647-79426669 ATTTTTTTAGGGTTGCTCTAGGG - Intronic
1071187838 10:83063861-83063883 AGATTGTTAGTGTTAGTATAAGG + Intergenic
1072347141 10:94519352-94519374 AGTTTGTTACAGTATCCATAGGG - Intronic
1075008774 10:118850688-118850710 AGTTTGTTGAAGTTGCTTTATGG + Intergenic
1075417685 10:122277434-122277456 AGTCTGTTTGTGTTGCTATAAGG + Intronic
1076308347 10:129481603-129481625 AGTTTTTTTTAGTAGCTATAGGG + Intronic
1076363834 10:129909583-129909605 AGTTTGTCACAGTTGCTCTCAGG - Intronic
1077653298 11:3994362-3994384 AGTTTATTAGATTTTCTTTATGG + Intronic
1083241004 11:61388634-61388656 AGTTTGGATGATTTGCTATAAGG + Intergenic
1085336080 11:75697167-75697189 AGTTTAGTATAGTTGCTAAATGG - Intergenic
1085433027 11:76472863-76472885 ATTCTGTCACAGTTGCTATATGG + Intronic
1085868948 11:80326772-80326794 AGGTTGTTAAAGATGATATATGG - Intergenic
1087046722 11:93849508-93849530 AGTTTATTAGGGTTGCCCTAAGG + Intronic
1087743247 11:101913733-101913755 AGAATATTAGAGTTGCTATTTGG - Intronic
1087926914 11:103929420-103929442 AGTTTATTGGAATTCCTATAGGG - Intronic
1088158036 11:106832930-106832952 AGTTTGCTAGGGCTGCTGTAAGG + Intronic
1089923863 11:122236930-122236952 ATTTTGTTAAACTTGCTATGGGG - Intergenic
1091829435 12:3539214-3539236 AGTTTGGAGGAGTTGATATATGG - Intronic
1092893762 12:12993781-12993803 ACATTGTTACAGGTGCTATAAGG + Intronic
1093295145 12:17380675-17380697 AGTTTTTTAGTTTTGCTATAAGG + Intergenic
1093659736 12:21741506-21741528 AATTTGTTAGACTTGTTTTATGG + Intronic
1094267516 12:28575527-28575549 AGTTTGAGAGAGTTGTTAAATGG + Intronic
1095203296 12:39410680-39410702 AATTTGTAAGACTTGCTTTATGG - Intronic
1096009387 12:48200129-48200151 AGTTTTTAAGAGCTGCTGTACGG - Intergenic
1096456440 12:51791180-51791202 TGTTTTTTAAAGTTGCTAAATGG - Intronic
1100432501 12:94543198-94543220 AGTTTGCTAGGGTTGCCATAAGG - Intergenic
1101846559 12:108367692-108367714 AGTTTCTCAGAGTTGCCATGTGG - Intergenic
1103985468 12:124764344-124764366 AGTTTGTGCGACTGGCTATAGGG - Intergenic
1104732241 12:131113929-131113951 AGTTTATTATAGTTTCTTTATGG + Intronic
1105946525 13:25195074-25195096 ATTTTTTTAGAGTAGCTTTAGGG - Intergenic
1106945455 13:34822861-34822883 ACTTTGTTAGATTTACTATGTGG - Intergenic
1109868329 13:68296793-68296815 TATTTGTTAGAGTTGTTATGAGG - Intergenic
1111289281 13:86143070-86143092 ATTTTTTTAGATTTGCCATATGG - Intergenic
1112724279 13:102284228-102284250 ATTTTGTCAGAGTTGCGATTTGG - Intronic
1116232708 14:42237557-42237579 ATTTGTTTAGAGTTGCTTTATGG + Intergenic
1118314986 14:64720674-64720696 AATTTGTTACAGTGGCAATAGGG - Intronic
1119990468 14:79191237-79191259 AGTTTGTTTGAGTTGGTGTCTGG - Intronic
1125010659 15:34870009-34870031 AGTTTCTTAGATTAGCTATGTGG + Intronic
1125303984 15:38289533-38289555 AGTTTGTGAGCTTTGATATAGGG + Intronic
1128263813 15:66251747-66251769 ACTTGCTTAGAGCTGCTATACGG - Intronic
1131662551 15:94533698-94533720 AGTTTTTTAAAGTTGCAATATGG - Intergenic
1134769165 16:16790695-16790717 AATTTGTTAAAGTTGTTTTATGG + Intergenic
1138238291 16:55404415-55404437 ACTTTGTTAGAGATGCTACAGGG + Intronic
1143695602 17:8614173-8614195 TATTTGTTAGACTTGCTTTATGG - Intronic
1147508268 17:41041902-41041924 AGTTTATCAGAGTTTCTATCTGG - Intergenic
1150565257 17:66333252-66333274 AGTTTGTTAGATTTTCTAATAGG - Intronic
1151439302 17:74117908-74117930 AGTGTATTAGAGTTGGTACAAGG + Intergenic
1154153511 18:11926196-11926218 AGTTTCTTAGAGCAGCAATAGGG - Intergenic
1158309860 18:56146154-56146176 AGTTTGTCAGAGTTACTCCAAGG + Intergenic
1159535652 18:69711914-69711936 AGTTTTTTAGGGTGACTATAAGG - Intronic
1163486190 19:17587880-17587902 AATGTGTTAGAGTAGCAATAGGG - Intergenic
1163509094 19:17724857-17724879 AGTTTGCTAGGGTTGCTCCAGGG + Intronic
1165181298 19:33973245-33973267 AGTCTGTTTGTGTTGCTAAAAGG - Intergenic
926589794 2:14728382-14728404 AGTTCATTCGTGTTGCTATAAGG - Intergenic
927116692 2:19910723-19910745 AGTTTGTTAGTGTTGTTATCTGG + Exonic
927641937 2:24850999-24851021 CGTTTTTCAAAGTTGCTATAGGG + Intronic
928245118 2:29620131-29620153 AGTTTGTTAGGGCTACTGTAAGG + Intronic
928737220 2:34306233-34306255 GGTATTTTAGAGTTGCTAAATGG - Intergenic
928742378 2:34370385-34370407 AGTTTTATAGTGTTGATATAAGG - Intergenic
929394601 2:41508348-41508370 AGTGTGTCAGAATTTCTATAGGG + Intergenic
930106473 2:47644184-47644206 AGTTGATTAGAGTTGGTAAATGG + Intergenic
930832487 2:55759753-55759775 AGTTTGTTACAGCTGCCAAAAGG - Intergenic
933054008 2:77638483-77638505 AGTATGTTTGCATTGCTATAAGG - Intergenic
933592148 2:84244914-84244936 AGCTTGTTAAAGTTGCTCTAAGG + Intergenic
939604401 2:144236118-144236140 AGTTTGTCAGATTTGCCAAAAGG + Intronic
947192290 2:227519571-227519593 GGTTTTTTAGACTTGCTAAAGGG + Intronic
1168915882 20:1486858-1486880 AGCTTGATAGAGTTGTTGTAGGG - Intronic
1169596878 20:7210494-7210516 AGTTTGTTAGATTAGGTACAAGG - Intergenic
1170019746 20:11823800-11823822 AGTTTTTAAGAGTTGGGATAAGG - Intergenic
1177781279 21:25624820-25624842 AGTTTGTTCAGGTTGCTATAAGG - Intergenic
1184223601 22:43116203-43116225 AGTCTGTTAGACTTCCTCTACGG + Intronic
950027642 3:9831656-9831678 ATTTTATTAGAGTTGCAAAATGG + Intronic
953164115 3:40449042-40449064 TGTTTGTTAGAAGTGCTATAAGG + Intergenic
953805317 3:46063066-46063088 ATTTTCTTAGAATTGCTATTGGG + Intergenic
955534899 3:59912523-59912545 AATTTTTTAGAGTCGCTAAAAGG + Intronic
957319714 3:78613909-78613931 AGTTTGCTACATTTGCTAAAGGG - Intronic
959029317 3:101279553-101279575 ACCTGGTTAGAGTTGCTCTATGG + Intronic
960204885 3:114884880-114884902 GGTTTGTTAGAGGAGCTACAGGG - Intronic
962444851 3:135455176-135455198 AATTTGTTAGAACTGCAATAGGG - Intergenic
962632943 3:137298451-137298473 AGTTTGTTATCGTTGCTTAATGG - Intergenic
963221997 3:142823038-142823060 AGTTTGTGAGAGTTTCCAAATGG + Intronic
963874908 3:150464158-150464180 AGTATTTTACAGTTGTTATATGG - Exonic
964979725 3:162664866-162664888 AGCTGGTTGGAGTTGCTCTAGGG - Intergenic
965974042 3:174599248-174599270 GGTTTAGTAGAGTGGCTATAAGG + Intronic
968781677 4:2587072-2587094 AGTCCGTTTGTGTTGCTATAAGG + Intronic
974297364 4:60019071-60019093 TGTTTGTTAGAGGTCCAATATGG + Intergenic
975793437 4:77981935-77981957 GGTTTGTTAGAGTTGGTTTAAGG + Intergenic
975965006 4:79962542-79962564 AATTTGTTATAGTTTCTTTAGGG - Intronic
976354518 4:84101506-84101528 TTTTTGTTACAGTTGCTCTAGGG - Intergenic
977044259 4:92050096-92050118 AGTTTCCTATTGTTGCTATAAGG + Intergenic
978373905 4:108055491-108055513 AGTTTTTCAGAGAAGCTATATGG - Intronic
983804202 4:171973268-171973290 AGTTTGCTAGGGCTGCCATAAGG + Intronic
984006325 4:174314296-174314318 AGTTTCTTAGCTGTGCTATAGGG - Intronic
986383802 5:7211271-7211293 AATTTGTTACAGTAGCTCTAGGG - Intergenic
990165206 5:52987046-52987068 AGTTTCTTAAAGTTGCAATGTGG - Intergenic
990624570 5:57597149-57597171 ACTTTGTTATAGCAGCTATAGGG - Intergenic
993842664 5:92900023-92900045 TGTTTCCTCGAGTTGCTATAAGG + Intergenic
994356995 5:98803834-98803856 AGTGTCTTACTGTTGCTATAAGG + Intergenic
994543112 5:101125587-101125609 AGAGTGTTGAAGTTGCTATAAGG - Intergenic
997124287 5:131210215-131210237 AGTCTGTTTGTGTTGCTATAAGG - Intergenic
998204970 5:140151622-140151644 ACCTTCTTAGAGTGGCTATAAGG - Intergenic
998324506 5:141268036-141268058 ATTTTGTTAGAAATGCTTTACGG + Intergenic
1000839460 5:166198976-166198998 AGTTTGCTAGAGTTGTTATCAGG + Intergenic
1000998128 5:167979588-167979610 AATTTCTAAGAGTTTCTATAGGG - Intronic
1001146110 5:169186184-169186206 AGGTTGTTAAAGTGGCTATCAGG + Intronic
1003706930 6:8542977-8542999 AGTTTGCTAGAGTTGCTCACAGG + Intergenic
1003978545 6:11367370-11367392 AGTCTGTTAAAGTTATTATATGG + Intronic
1010935621 6:81857858-81857880 AGTTTGTAAGAGTGGGTACAAGG + Intergenic
1011440962 6:87386959-87386981 AATTTATTATAGTTTCTATATGG - Intronic
1011870641 6:91887771-91887793 AGTTGATTGGATTTGCTATATGG - Intergenic
1012758887 6:103270290-103270312 AGTTTGTTGTAGTTGTTTTAAGG + Intergenic
1014531607 6:122565654-122565676 TGTTTTTTACAGTAGCTATAGGG - Intronic
1015211923 6:130708446-130708468 AGTCTGTTTGTGTTGCTATAAGG + Intergenic
1015307522 6:131726351-131726373 AGGTTGTTATAGGTGCTACACGG + Intronic
1016154943 6:140794126-140794148 AGTTTGTTAAGGTGGCTTTATGG + Intergenic
1018711388 6:166500280-166500302 ATTTTGTTGCAGATGCTATAGGG + Intronic
1019627893 7:2030398-2030420 GCTTTGTTCGAGCTGCTATACGG - Intronic
1027497960 7:78911597-78911619 ATTTTGTTACAGTAGCTCTAAGG + Intronic
1028304789 7:89249380-89249402 AATTTGTTAAAACTGCTATATGG - Intronic
1028426548 7:90696156-90696178 AGCTTGTTGGAGTGGATATAGGG + Intronic
1030379424 7:108795348-108795370 AGGCTGTTAAAGTAGCTATAAGG + Intergenic
1030909570 7:115229858-115229880 AGTTTGTTAGAGCTGCAAATTGG + Intergenic
1031252462 7:119404550-119404572 ATTGGGTTAGAGTAGCTATATGG - Intergenic
1032941662 7:136799931-136799953 ATTTGGATAGAGTTGCAATAAGG + Intergenic
1036114401 8:5943209-5943231 AGTTTCCTAGACCTGCTATAAGG + Intergenic
1036934332 8:12986616-12986638 GGTTTATTAGAGTTTATATATGG + Intronic
1050435393 9:5604123-5604145 ATTTTGTGAGACTTGCCATATGG - Intergenic
1050503379 9:6322173-6322195 AGTCTGTTTGTGTTGCTATACGG - Intergenic
1051252552 9:15176332-15176354 ATTTTATTAGTGTTTCTATAAGG - Intronic
1053449817 9:38184032-38184054 TGTTTGTTTGTGTTGCTAAAAGG + Intergenic
1054895735 9:70308939-70308961 AGTTTGTATGACTTGCTTTATGG - Intronic
1058166870 9:101629508-101629530 AGGTTTTAAGAGTTCCTATATGG - Intronic
1058926050 9:109665465-109665487 AGTTTGCTAGAGTTGCACTCCGG + Intronic
1059072768 9:111156480-111156502 AGTTTCTTGGAGTTTCTAGATGG - Intergenic
1059614952 9:115939409-115939431 AGCTTGATAGAGCTGTTATAGGG - Intergenic
1060717970 9:125951881-125951903 GGTTTGATACAGTTTCTATAAGG - Intronic
1186626596 X:11300284-11300306 AGTTTCTTAGAGTTGTTTTATGG + Intronic
1187747560 X:22426255-22426277 AGTCTGTTTCTGTTGCTATAAGG + Intergenic
1187846113 X:23540017-23540039 AATTTGTTATAGTAGCTCTAGGG + Intergenic
1187853274 X:23612124-23612146 AGTTTGTGGGAGTTGATATTTGG - Intergenic
1188074712 X:25760897-25760919 AGTTTGTTGGAGTTGGTATTTGG - Intergenic
1189103547 X:38214687-38214709 TGTCTGTCAGAGTTCCTATAAGG + Intronic
1189170975 X:38909061-38909083 AGTTTGTTTGAGCTTCAATATGG + Intergenic
1189403944 X:40700612-40700634 AGTTTGTTAGAGTTGCTATAAGG + Intronic
1191891536 X:65947611-65947633 AATTTGTAAGTGTTGCTTTAGGG + Intergenic
1192960152 X:76121516-76121538 AGTTTATTTGCATTGCTATAGGG - Intergenic
1194734852 X:97499987-97500009 GGTTTGTTAGATATGCGATATGG + Intronic
1197586465 X:128353861-128353883 AACTTGTTAGAGTTGCTGCATGG + Intergenic
1197641536 X:128973430-128973452 AGACTATTATAGTTGCTATAAGG + Intergenic
1198179086 X:134187227-134187249 GGTTTGTTTTGGTTGCTATATGG + Intergenic
1198376120 X:136041724-136041746 ACTTTGTTACAGCTGCTCTAGGG - Intronic
1198788990 X:140322051-140322073 AGATTGTTATAGCTGTTATATGG - Intergenic
1200356092 X:155553082-155553104 AGTTTTTGAGATTTGCTTTATGG + Intronic