ID: 1189412003

View in Genome Browser
Species Human (GRCh38)
Location X:40780596-40780618
Sequence AAGGAGAGCACAGTGATGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189412003_1189412013 26 Left 1189412003 X:40780596-40780618 CCCACCATCACTGTGCTCTCCTT No data
Right 1189412013 X:40780645-40780667 CACACCATGCAGCTGCTTCTGGG No data
1189412003_1189412012 25 Left 1189412003 X:40780596-40780618 CCCACCATCACTGTGCTCTCCTT No data
Right 1189412012 X:40780644-40780666 CCACACCATGCAGCTGCTTCTGG No data
1189412003_1189412014 27 Left 1189412003 X:40780596-40780618 CCCACCATCACTGTGCTCTCCTT No data
Right 1189412014 X:40780646-40780668 ACACCATGCAGCTGCTTCTGGGG No data
1189412003_1189412015 28 Left 1189412003 X:40780596-40780618 CCCACCATCACTGTGCTCTCCTT No data
Right 1189412015 X:40780647-40780669 CACCATGCAGCTGCTTCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189412003 Original CRISPR AAGGAGAGCACAGTGATGGT GGG (reversed) Intergenic
No off target data available for this crispr