ID: 1189413373

View in Genome Browser
Species Human (GRCh38)
Location X:40792967-40792989
Sequence GTTCAAGGTGGCCGTCACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189413373_1189413383 24 Left 1189413373 X:40792967-40792989 CCTGGGTGACGGCCACCTTGAAC No data
Right 1189413383 X:40793014-40793036 TACTTAGGAAGTCCAAAGCAGGG No data
1189413373_1189413382 23 Left 1189413373 X:40792967-40792989 CCTGGGTGACGGCCACCTTGAAC No data
Right 1189413382 X:40793013-40793035 ATACTTAGGAAGTCCAAAGCAGG No data
1189413373_1189413379 -2 Left 1189413373 X:40792967-40792989 CCTGGGTGACGGCCACCTTGAAC No data
Right 1189413379 X:40792988-40793010 ACGAGGGGCCATTATTGCTCTGG No data
1189413373_1189413381 9 Left 1189413373 X:40792967-40792989 CCTGGGTGACGGCCACCTTGAAC No data
Right 1189413381 X:40792999-40793021 TTATTGCTCTGGAGATACTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189413373 Original CRISPR GTTCAAGGTGGCCGTCACCC AGG (reversed) Intergenic
No off target data available for this crispr