ID: 1189413377

View in Genome Browser
Species Human (GRCh38)
Location X:40792979-40793001
Sequence TAATGGCCCCTCGTTCAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189413377_1189413381 -3 Left 1189413377 X:40792979-40793001 CCACCTTGAACGAGGGGCCATTA No data
Right 1189413381 X:40792999-40793021 TTATTGCTCTGGAGATACTTAGG No data
1189413377_1189413382 11 Left 1189413377 X:40792979-40793001 CCACCTTGAACGAGGGGCCATTA No data
Right 1189413382 X:40793013-40793035 ATACTTAGGAAGTCCAAAGCAGG No data
1189413377_1189413383 12 Left 1189413377 X:40792979-40793001 CCACCTTGAACGAGGGGCCATTA No data
Right 1189413383 X:40793014-40793036 TACTTAGGAAGTCCAAAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189413377 Original CRISPR TAATGGCCCCTCGTTCAAGG TGG (reversed) Intergenic
No off target data available for this crispr