ID: 1189413379

View in Genome Browser
Species Human (GRCh38)
Location X:40792988-40793010
Sequence ACGAGGGGCCATTATTGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189413370_1189413379 1 Left 1189413370 X:40792964-40792986 CCCCCTGGGTGACGGCCACCTTG No data
Right 1189413379 X:40792988-40793010 ACGAGGGGCCATTATTGCTCTGG No data
1189413373_1189413379 -2 Left 1189413373 X:40792967-40792989 CCTGGGTGACGGCCACCTTGAAC No data
Right 1189413379 X:40792988-40793010 ACGAGGGGCCATTATTGCTCTGG No data
1189413371_1189413379 0 Left 1189413371 X:40792965-40792987 CCCCTGGGTGACGGCCACCTTGA No data
Right 1189413379 X:40792988-40793010 ACGAGGGGCCATTATTGCTCTGG No data
1189413372_1189413379 -1 Left 1189413372 X:40792966-40792988 CCCTGGGTGACGGCCACCTTGAA No data
Right 1189413379 X:40792988-40793010 ACGAGGGGCCATTATTGCTCTGG No data
1189413368_1189413379 10 Left 1189413368 X:40792955-40792977 CCTTTGAGACCCCCTGGGTGACG 0: 3
1: 3
2: 11
3: 15
4: 74
Right 1189413379 X:40792988-40793010 ACGAGGGGCCATTATTGCTCTGG No data
1189413365_1189413379 17 Left 1189413365 X:40792948-40792970 CCAAGTGCCTTTGAGACCCCCTG 0: 6
1: 14
2: 23
3: 25
4: 186
Right 1189413379 X:40792988-40793010 ACGAGGGGCCATTATTGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189413379 Original CRISPR ACGAGGGGCCATTATTGCTC TGG Intergenic
No off target data available for this crispr