ID: 1189413380

View in Genome Browser
Species Human (GRCh38)
Location X:40792996-40793018
Sequence AAGTATCTCCAGAGCAATAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189413380_1189413382 -6 Left 1189413380 X:40792996-40793018 CCATTATTGCTCTGGAGATACTT No data
Right 1189413382 X:40793013-40793035 ATACTTAGGAAGTCCAAAGCAGG No data
1189413380_1189413383 -5 Left 1189413380 X:40792996-40793018 CCATTATTGCTCTGGAGATACTT No data
Right 1189413383 X:40793014-40793036 TACTTAGGAAGTCCAAAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189413380 Original CRISPR AAGTATCTCCAGAGCAATAA TGG (reversed) Intergenic
No off target data available for this crispr