ID: 1189413382

View in Genome Browser
Species Human (GRCh38)
Location X:40793013-40793035
Sequence ATACTTAGGAAGTCCAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189413373_1189413382 23 Left 1189413373 X:40792967-40792989 CCTGGGTGACGGCCACCTTGAAC No data
Right 1189413382 X:40793013-40793035 ATACTTAGGAAGTCCAAAGCAGG No data
1189413380_1189413382 -6 Left 1189413380 X:40792996-40793018 CCATTATTGCTCTGGAGATACTT No data
Right 1189413382 X:40793013-40793035 ATACTTAGGAAGTCCAAAGCAGG No data
1189413370_1189413382 26 Left 1189413370 X:40792964-40792986 CCCCCTGGGTGACGGCCACCTTG No data
Right 1189413382 X:40793013-40793035 ATACTTAGGAAGTCCAAAGCAGG No data
1189413371_1189413382 25 Left 1189413371 X:40792965-40792987 CCCCTGGGTGACGGCCACCTTGA No data
Right 1189413382 X:40793013-40793035 ATACTTAGGAAGTCCAAAGCAGG No data
1189413378_1189413382 8 Left 1189413378 X:40792982-40793004 CCTTGAACGAGGGGCCATTATTG No data
Right 1189413382 X:40793013-40793035 ATACTTAGGAAGTCCAAAGCAGG No data
1189413372_1189413382 24 Left 1189413372 X:40792966-40792988 CCCTGGGTGACGGCCACCTTGAA No data
Right 1189413382 X:40793013-40793035 ATACTTAGGAAGTCCAAAGCAGG No data
1189413377_1189413382 11 Left 1189413377 X:40792979-40793001 CCACCTTGAACGAGGGGCCATTA No data
Right 1189413382 X:40793013-40793035 ATACTTAGGAAGTCCAAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189413382 Original CRISPR ATACTTAGGAAGTCCAAAGC AGG Intergenic
No off target data available for this crispr