ID: 1189416205 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:40816594-40816616 |
| Sequence | CTGTTGAATGGAAAGTGGGA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1189416205_1189416210 | 4 | Left | 1189416205 | X:40816594-40816616 | CCATCCCACTTTCCATTCAACAG | No data | ||
| Right | 1189416210 | X:40816621-40816643 | TTCCAGATTCTAAACAATATGGG | No data | ||||
| 1189416205_1189416209 | 3 | Left | 1189416205 | X:40816594-40816616 | CCATCCCACTTTCCATTCAACAG | No data | ||
| Right | 1189416209 | X:40816620-40816642 | ATTCCAGATTCTAAACAATATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1189416205 | Original CRISPR | CTGTTGAATGGAAAGTGGGA TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||