ID: 1189416205

View in Genome Browser
Species Human (GRCh38)
Location X:40816594-40816616
Sequence CTGTTGAATGGAAAGTGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189416205_1189416210 4 Left 1189416205 X:40816594-40816616 CCATCCCACTTTCCATTCAACAG No data
Right 1189416210 X:40816621-40816643 TTCCAGATTCTAAACAATATGGG No data
1189416205_1189416209 3 Left 1189416205 X:40816594-40816616 CCATCCCACTTTCCATTCAACAG No data
Right 1189416209 X:40816620-40816642 ATTCCAGATTCTAAACAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189416205 Original CRISPR CTGTTGAATGGAAAGTGGGA TGG (reversed) Intergenic
No off target data available for this crispr