ID: 1189418242

View in Genome Browser
Species Human (GRCh38)
Location X:40833145-40833167
Sequence CGGCGGCCGTGCGGCCTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189418242_1189418254 19 Left 1189418242 X:40833145-40833167 CCTGGGAGGCCGCACGGCCGCCG No data
Right 1189418254 X:40833187-40833209 CCTGTCGGCTCTCTATCTTGAGG No data
1189418242_1189418255 20 Left 1189418242 X:40833145-40833167 CCTGGGAGGCCGCACGGCCGCCG No data
Right 1189418255 X:40833188-40833210 CTGTCGGCTCTCTATCTTGAGGG No data
1189418242_1189418247 -6 Left 1189418242 X:40833145-40833167 CCTGGGAGGCCGCACGGCCGCCG No data
Right 1189418247 X:40833162-40833184 CCGCCGGCAACTTCGGTGCCCGG No data
1189418242_1189418249 4 Left 1189418242 X:40833145-40833167 CCTGGGAGGCCGCACGGCCGCCG No data
Right 1189418249 X:40833172-40833194 CTTCGGTGCCCGGACCCTGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189418242 Original CRISPR CGGCGGCCGTGCGGCCTCCC AGG (reversed) Intergenic