ID: 1189420457

View in Genome Browser
Species Human (GRCh38)
Location X:40852701-40852723
Sequence TTCTAAGGCTCTTGAGGCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189420457_1189420465 12 Left 1189420457 X:40852701-40852723 CCATTGCCTCAAGAGCCTTAGAA No data
Right 1189420465 X:40852736-40852758 AGTAGAAGCTGAAAGAGGAAGGG No data
1189420457_1189420466 24 Left 1189420457 X:40852701-40852723 CCATTGCCTCAAGAGCCTTAGAA No data
Right 1189420466 X:40852748-40852770 AAGAGGAAGGGTCACCAGCCAGG No data
1189420457_1189420463 7 Left 1189420457 X:40852701-40852723 CCATTGCCTCAAGAGCCTTAGAA No data
Right 1189420463 X:40852731-40852753 TGGGAAGTAGAAGCTGAAAGAGG No data
1189420457_1189420464 11 Left 1189420457 X:40852701-40852723 CCATTGCCTCAAGAGCCTTAGAA No data
Right 1189420464 X:40852735-40852757 AAGTAGAAGCTGAAAGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189420457 Original CRISPR TTCTAAGGCTCTTGAGGCAA TGG (reversed) Intergenic
No off target data available for this crispr