ID: 1189420458

View in Genome Browser
Species Human (GRCh38)
Location X:40852707-40852729
Sequence AGGAATTTCTAAGGCTCTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189420458_1189420465 6 Left 1189420458 X:40852707-40852729 CCTCAAGAGCCTTAGAAATTCCT No data
Right 1189420465 X:40852736-40852758 AGTAGAAGCTGAAAGAGGAAGGG No data
1189420458_1189420466 18 Left 1189420458 X:40852707-40852729 CCTCAAGAGCCTTAGAAATTCCT No data
Right 1189420466 X:40852748-40852770 AAGAGGAAGGGTCACCAGCCAGG No data
1189420458_1189420464 5 Left 1189420458 X:40852707-40852729 CCTCAAGAGCCTTAGAAATTCCT No data
Right 1189420464 X:40852735-40852757 AAGTAGAAGCTGAAAGAGGAAGG No data
1189420458_1189420467 29 Left 1189420458 X:40852707-40852729 CCTCAAGAGCCTTAGAAATTCCT No data
Right 1189420467 X:40852759-40852781 TCACCAGCCAGGCTAAACTCTGG No data
1189420458_1189420463 1 Left 1189420458 X:40852707-40852729 CCTCAAGAGCCTTAGAAATTCCT No data
Right 1189420463 X:40852731-40852753 TGGGAAGTAGAAGCTGAAAGAGG No data
1189420458_1189420468 30 Left 1189420458 X:40852707-40852729 CCTCAAGAGCCTTAGAAATTCCT No data
Right 1189420468 X:40852760-40852782 CACCAGCCAGGCTAAACTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189420458 Original CRISPR AGGAATTTCTAAGGCTCTTG AGG (reversed) Intergenic
No off target data available for this crispr