ID: 1189420464

View in Genome Browser
Species Human (GRCh38)
Location X:40852735-40852757
Sequence AAGTAGAAGCTGAAAGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189420457_1189420464 11 Left 1189420457 X:40852701-40852723 CCATTGCCTCAAGAGCCTTAGAA No data
Right 1189420464 X:40852735-40852757 AAGTAGAAGCTGAAAGAGGAAGG No data
1189420458_1189420464 5 Left 1189420458 X:40852707-40852729 CCTCAAGAGCCTTAGAAATTCCT No data
Right 1189420464 X:40852735-40852757 AAGTAGAAGCTGAAAGAGGAAGG No data
1189420461_1189420464 -4 Left 1189420461 X:40852716-40852738 CCTTAGAAATTCCTCTGGGAAGT No data
Right 1189420464 X:40852735-40852757 AAGTAGAAGCTGAAAGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189420464 Original CRISPR AAGTAGAAGCTGAAAGAGGA AGG Intergenic
No off target data available for this crispr