ID: 1189427727

View in Genome Browser
Species Human (GRCh38)
Location X:40916485-40916507
Sequence TGCCAAAAGGCTAATGGGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189427727_1189427733 12 Left 1189427727 X:40916485-40916507 CCTACCCCATTAGCCTTTTGGCA No data
Right 1189427733 X:40916520-40916542 TCCCTTACCTATAACCTGATAGG No data
1189427727_1189427735 13 Left 1189427727 X:40916485-40916507 CCTACCCCATTAGCCTTTTGGCA No data
Right 1189427735 X:40916521-40916543 CCCTTACCTATAACCTGATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189427727 Original CRISPR TGCCAAAAGGCTAATGGGGT AGG (reversed) Intergenic
No off target data available for this crispr