ID: 1189437018

View in Genome Browser
Species Human (GRCh38)
Location X:41001959-41001981
Sequence TCCCAAGTTCAACACCCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189437018_1189437021 20 Left 1189437018 X:41001959-41001981 CCCTGGGGGTGTTGAACTTGGGA No data
Right 1189437021 X:41002002-41002024 GCACCTGCCCGGTGTGAAGCTGG No data
1189437018_1189437020 9 Left 1189437018 X:41001959-41001981 CCCTGGGGGTGTTGAACTTGGGA No data
Right 1189437020 X:41001991-41002013 ACTAAGTCACTGCACCTGCCCGG No data
1189437018_1189437025 28 Left 1189437018 X:41001959-41001981 CCCTGGGGGTGTTGAACTTGGGA No data
Right 1189437025 X:41002010-41002032 CCGGTGTGAAGCTGGAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189437018 Original CRISPR TCCCAAGTTCAACACCCCCA GGG (reversed) Intergenic