ID: 1189442073

View in Genome Browser
Species Human (GRCh38)
Location X:41046240-41046262
Sequence CAGAAGGAGCTCCCTGCAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189442073_1189442078 2 Left 1189442073 X:41046240-41046262 CCCTTTGCAGGGAGCTCCTTCTG No data
Right 1189442078 X:41046265-41046287 GTGATGGCTGATCAGCCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189442073 Original CRISPR CAGAAGGAGCTCCCTGCAAA GGG (reversed) Intergenic
No off target data available for this crispr