ID: 1189442078

View in Genome Browser
Species Human (GRCh38)
Location X:41046265-41046287
Sequence GTGATGGCTGATCAGCCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189442071_1189442078 7 Left 1189442071 X:41046235-41046257 CCCAACCCTTTGCAGGGAGCTCC No data
Right 1189442078 X:41046265-41046287 GTGATGGCTGATCAGCCTGCTGG No data
1189442070_1189442078 12 Left 1189442070 X:41046230-41046252 CCAAGCCCAACCCTTTGCAGGGA No data
Right 1189442078 X:41046265-41046287 GTGATGGCTGATCAGCCTGCTGG No data
1189442072_1189442078 6 Left 1189442072 X:41046236-41046258 CCAACCCTTTGCAGGGAGCTCCT No data
Right 1189442078 X:41046265-41046287 GTGATGGCTGATCAGCCTGCTGG No data
1189442073_1189442078 2 Left 1189442073 X:41046240-41046262 CCCTTTGCAGGGAGCTCCTTCTG No data
Right 1189442078 X:41046265-41046287 GTGATGGCTGATCAGCCTGCTGG No data
1189442074_1189442078 1 Left 1189442074 X:41046241-41046263 CCTTTGCAGGGAGCTCCTTCTGG No data
Right 1189442078 X:41046265-41046287 GTGATGGCTGATCAGCCTGCTGG No data
1189442067_1189442078 28 Left 1189442067 X:41046214-41046236 CCAGTACTGAAGTCAGCCAAGCC No data
Right 1189442078 X:41046265-41046287 GTGATGGCTGATCAGCCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189442078 Original CRISPR GTGATGGCTGATCAGCCTGC TGG Intergenic
No off target data available for this crispr