ID: 1189443830

View in Genome Browser
Species Human (GRCh38)
Location X:41062119-41062141
Sequence CTCCATTGTGGGGCTGGGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189443824_1189443830 13 Left 1189443824 X:41062083-41062105 CCTCAATTTTAAAATTACACTTC No data
Right 1189443830 X:41062119-41062141 CTCCATTGTGGGGCTGGGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189443830 Original CRISPR CTCCATTGTGGGGCTGGGCA CGG Intergenic
No off target data available for this crispr