ID: 1189446837

View in Genome Browser
Species Human (GRCh38)
Location X:41087337-41087359
Sequence AAGGGTAATCAGCTCCGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 2, 3: 1, 4: 72}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189446837_1189446845 13 Left 1189446837 X:41087337-41087359 CCCTCTCGGAGCTGATTACCCTT 0: 1
1: 0
2: 2
3: 1
4: 72
Right 1189446845 X:41087373-41087395 TTAACCATGACTAGCTTGGCTGG 0: 1
1: 0
2: 0
3: 13
4: 153
1189446837_1189446843 9 Left 1189446837 X:41087337-41087359 CCCTCTCGGAGCTGATTACCCTT 0: 1
1: 0
2: 2
3: 1
4: 72
Right 1189446843 X:41087369-41087391 CTCCTTAACCATGACTAGCTTGG 0: 1
1: 0
2: 0
3: 10
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189446837 Original CRISPR AAGGGTAATCAGCTCCGAGA GGG (reversed) Intronic
902210169 1:14899295-14899317 AAGGGTAATGAGGGCCCAGAGGG - Intronic
902752538 1:18527278-18527300 AGGGGAAATCAGCTGGGAGAGGG - Intergenic
902908113 1:19574286-19574308 AAGGGTAATAAGTTCAGAAAGGG - Intergenic
914702208 1:150145080-150145102 AAGGGTTATCAGAGCCTAGAGGG + Exonic
920945869 1:210528068-210528090 AAGCATAATAAGCTCCCAGACGG - Intronic
1073251568 10:102123044-102123066 AAGGGTAATCTTCCCAGAGAAGG - Intergenic
1074639052 10:115358039-115358061 AAGGGCAATGAACTCCAAGAAGG - Intronic
1076153982 10:128188675-128188697 AAGGACATTCAGCTCAGAGATGG - Intergenic
1076866325 10:133168086-133168108 AAGGGAAATCAGCTCCTTAACGG - Intronic
1080283778 11:30586023-30586045 AAAGGTAATCCGCCCCGGGAAGG - Intronic
1083326355 11:61874926-61874948 AAGGAACATCAGCTCCAAGAGGG + Intronic
1087100833 11:94362896-94362918 CAGGGCAATCAGGCCCGAGAAGG + Intergenic
1090648430 11:128785419-128785441 AAGGGTACACAGCTACTAGATGG + Intronic
1090976205 11:131682770-131682792 AAGGGGATCCAGCACCGAGAGGG - Intronic
1102026193 12:109715287-109715309 AAGGGAAATCACCTCAGAGGGGG + Intronic
1103828135 12:123756636-123756658 AAAGCCAGTCAGCTCCGAGACGG - Intronic
1106554354 13:30797424-30797446 TAGGGAAACCAGCTCAGAGAAGG + Intergenic
1110094696 13:71502480-71502502 ATGGTTAAACAGCTCCGACAAGG - Intronic
1121241392 14:92432562-92432584 AAGGTTTGTCAGCTCAGAGATGG - Intronic
1121396201 14:93625284-93625306 GAGGGTATGCAGCTCAGAGAGGG - Intronic
1132710284 16:1263313-1263335 AAGAGAAAGCAGCTCCGGGAGGG - Intergenic
1136115840 16:28093764-28093786 AGGTGGAGTCAGCTCCGAGATGG - Intergenic
1136186396 16:28591159-28591181 CAGGAGAACCAGCTCCGAGATGG + Intronic
1137501593 16:49015421-49015443 AAGGGAACTCAGCGCCGAGCTGG - Intergenic
1145308316 17:21687715-21687737 CAGGGAAATGAGCTCTGAGAGGG - Intergenic
1153600221 18:6773866-6773888 AAGTGTAATCAGCCTCAAGAAGG - Intronic
1159592731 18:70352621-70352643 ATGGTTAATCAGCTACAAGATGG - Intergenic
1163187601 19:15649936-15649958 AAGGGCACTGAGCTCCAAGATGG - Exonic
1163191954 19:15683516-15683538 AAGGGCACTGAGCTCCAAGATGG - Exonic
1163201274 19:15771210-15771232 AAGGGCACTGAGCTCCAAGATGG + Intergenic
1163217196 19:15889648-15889670 AAGGGCACTGAGCTCCAAGATGG + Exonic
941516986 2:166492216-166492238 AGGGGTCATCAGATCCCAGATGG - Intronic
1172681891 20:36722709-36722731 TATGGTAGTCAGCTCCAAGATGG + Intronic
1176347501 21:5763357-5763379 AAGGGGAATCAGCAAGGAGATGG - Intergenic
1176354315 21:5883941-5883963 AAGGGGAATCAGCAAGGAGATGG - Intergenic
1176497326 21:7561098-7561120 AAGGGGAATCAGCAAGGAGATGG + Intergenic
1176541822 21:8161427-8161449 AAGGGGAATCAGCAAGGAGATGG - Intergenic
1176560773 21:8344472-8344494 AAGGGGAATCAGCAAGGAGATGG - Intergenic
1182088400 22:27577284-27577306 AAAGGGAAACAGCTCAGAGAAGG - Intergenic
1182399372 22:30062950-30062972 AGGGGTCATCTGCTCAGAGAGGG - Intergenic
1182428774 22:30288507-30288529 AAGAGAAAACAGCTCAGAGAGGG + Intronic
1182478626 22:30591671-30591693 GACCGTAATCAGCTGCGAGAAGG - Intronic
1183273792 22:36878454-36878476 AAGGAGATTCAGCTCAGAGAAGG - Intergenic
1183403090 22:37616248-37616270 AAGGTTACTCAGCTAAGAGAGGG - Intronic
1183713012 22:39517507-39517529 AAGGGGAATCAGCTTCAGGATGG + Exonic
1203246762 22_KI270733v1_random:77846-77868 AAGGGGAATCAGCAAGGAGATGG - Intergenic
955989683 3:64613132-64613154 AAGGGTAATCAGCTCCAGGAGGG + Intronic
959187018 3:103057349-103057371 AAGGGTGGGCAGCTCCCAGAGGG + Intergenic
961574200 3:127821824-127821846 AAGGGTCTTCAGGTCCTAGAAGG + Exonic
962967822 3:140370755-140370777 AAAGCTATTCAGCTCCCAGAAGG - Intronic
964357462 3:155863766-155863788 AAAGGTAGTCATCTCTGAGAGGG - Intergenic
964746827 3:160020400-160020422 AAGGGCAATGAGATCCTAGAGGG - Intronic
968525229 4:1053599-1053621 AAGGGTAGTCAGCTCCCAGAGGG + Intergenic
974951723 4:68591130-68591152 ATGGGTGAACAGCTCCCAGAAGG + Intronic
977438548 4:97032960-97032982 AAGGGTAATAAGCTTTGAAATGG + Intergenic
978393076 4:108247970-108247992 AAGGCTAATTAGCTCCTAGCTGG - Intergenic
986756087 5:10838050-10838072 AAGGGTAAACATCTGAGAGAGGG - Intergenic
987003555 5:13686434-13686456 AAGGAAAAGCAGCTCTGAGAAGG - Intergenic
989393202 5:40924196-40924218 AAGAGAAATCAGCTACTAGAAGG + Intronic
990401758 5:55445116-55445138 AAGTTTAATCAGCTCTGAGAAGG - Intronic
997963498 5:138339270-138339292 AAGGCAAACCAGCTCCGCGAGGG - Intronic
1001718076 5:173833585-173833607 AAGGGTAGTCAGCCTGGAGAAGG - Intergenic
1010302483 6:74278186-74278208 AGGGATCATCAGCTCCCAGAAGG - Intergenic
1014385562 6:120797694-120797716 CAGGGTAATCAGGCCAGAGAAGG - Intergenic
1020866897 7:13575765-13575787 AGTGGTAATTAGCTCTGAGAGGG - Intergenic
1024943495 7:54785663-54785685 AAGGCTAATAAGCACTGAGATGG + Intergenic
1035028489 7:155842677-155842699 AAGGGTGGTCAGCACTGAGATGG + Intergenic
1038768553 8:30454056-30454078 AAAGGTAATCTGCTGGGAGAAGG - Intronic
1044191219 8:89319960-89319982 AAGGAGAATCAGCTCCTTGAGGG + Intergenic
1045842094 8:106592538-106592560 TAGGGTAGTCTGCTCTGAGAAGG + Intronic
1046108732 8:109695768-109695790 AAGGATTATAAGCTCAGAGAGGG - Intergenic
1046985283 8:120381211-120381233 AATTGTAATAAGCTCCTAGACGG - Intronic
1048607534 8:135985105-135985127 GAGGGTAATCAGCTTTTAGAGGG - Intergenic
1203463096 Un_GL000220v1:60908-60930 AAGGGGAATCAGCAAGGAGATGG - Intergenic
1189446837 X:41087337-41087359 AAGGGTAATCAGCTCCGAGAGGG - Intronic
1194722589 X:97357533-97357555 AAGGGTAATCTACACCGAAATGG - Intronic